ID: 1056765261

View in Genome Browser
Species Human (GRCh38)
Location 9:89441233-89441255
Sequence TGGAAGCGGAGGCCAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765261_1056765271 3 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765261_1056765273 24 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765273 9:89441280-89441302 GGCACTGTTCCTCCCAGCAGCGG No data
1056765261_1056765269 -1 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765261_1056765267 -5 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765261_1056765270 0 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765261_1056765274 25 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765274 9:89441281-89441303 GCACTGTTCCTCCCAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765261 Original CRISPR TGGAAGCGGAGGCCAAGGGT TGG (reversed) Intronic
900808001 1:4780514-4780536 TGGAAGAGGTGGGCAGGGGTGGG + Intronic
901157827 1:7152407-7152429 TGGAGGGGGAGCCCAAGGTTGGG - Intronic
901168109 1:7234286-7234308 TGGAAGCGGAGGCGAAGGCAAGG - Intronic
901402158 1:9021876-9021898 AGGAAGTGGAGGCCAAGACTGGG + Intronic
901631429 1:10649973-10649995 TGGGGGCGGAGGCCAAAGGAAGG + Intronic
901649211 1:10733816-10733838 TAGAAGAGGGGGCCAAGGCTGGG - Intronic
901881356 1:12195689-12195711 TGGAGGAGGAGGACAAGGGAGGG + Intronic
901975627 1:12941939-12941961 GGGAGGCTGAGGCCAAGAGTTGG - Intronic
902009547 1:13259826-13259848 GGGAGGCTGAGGCCAAGAGTTGG + Intronic
903140836 1:21338261-21338283 TGGAAACTGGAGCCAAGGGTGGG - Intronic
904013164 1:27401760-27401782 AGGAAGCTGAGGCCCAAGGTGGG + Intergenic
904498115 1:30898826-30898848 TGGAAGTGGAGGCCCAGAGAGGG + Intronic
904560529 1:31394447-31394469 GGGAAACTGAGGCCCAGGGTAGG + Intergenic
904927061 1:34057622-34057644 GGGAAGCGGTGGCCAAGAGGCGG - Intronic
905651677 1:39661005-39661027 TGGGAGTGCAGGCCAAGGGCAGG + Intronic
906495272 1:46301270-46301292 TGGGTGCGGAGGCCCAGGTTGGG - Intronic
906951815 1:50341033-50341055 GGGAAGGGGAGGCCAAGAGGAGG - Intergenic
907158469 1:52354996-52355018 TGGAAATGGAGGCCCAGGGCTGG + Intronic
908622558 1:66000734-66000756 TGGAAGAGGAGGACAAGCCTTGG - Intronic
908736102 1:67278438-67278460 TGGAAGCAGAAACCAAGGGTCGG + Intergenic
908815790 1:68032360-68032382 TGGAAGGGGAGGCAAGGGGCAGG + Intergenic
916922754 1:169485991-169486013 TGGAGGCGGTGGCAGAGGGTGGG - Exonic
917403930 1:174683191-174683213 AGGAGGCAGAGGCAAAGGGTGGG - Intronic
918549220 1:185721214-185721236 TTGGGGTGGAGGCCAAGGGTAGG + Intergenic
918773690 1:188599560-188599582 TGGCACAGGAGGCCAAGGGAAGG + Intergenic
919922670 1:202175751-202175773 TGGGAGGGGAGGCCCAGGGTAGG - Intergenic
919973144 1:202593632-202593654 TGGAAGCTGAGGCCTGGGGAAGG - Exonic
920872580 1:209806293-209806315 TAGAAGCGGAGGAGTAGGGTGGG - Intergenic
922857084 1:228784426-228784448 TGGAAGGTGAGGGCAAGGGAGGG - Intergenic
923298785 1:232621277-232621299 GGGAAGTGGAGGCTGAGGGTTGG - Intergenic
1063072510 10:2680400-2680422 TGAAAGCGGAGTCTCAGGGTGGG - Intergenic
1063790297 10:9437285-9437307 TGGAGGCGGAGGTGAAGGCTTGG + Intergenic
1066179163 10:32942906-32942928 TGGAAGTGGGGGCCAGGGGAAGG + Intronic
1067717608 10:48701562-48701584 TGGAGGCTGAGGCCAAGGAAGGG + Intronic
1069546586 10:69333594-69333616 AGGAAGAGGGGGCCAAGGGAAGG + Intronic
1069807719 10:71136440-71136462 AGGAATCGGAGGCCCAGGGAGGG + Intergenic
1069830378 10:71279140-71279162 GGGAAGAAGAGGCCAAGGGATGG + Intronic
1069861768 10:71475940-71475962 TGGAAACTGAGGCCCAGGGAGGG - Intronic
1069992478 10:72323892-72323914 TGGATGAGGAGGACAAAGGTGGG - Intergenic
1070149857 10:73799036-73799058 TGGAAGAGGCAGCTAAGGGTGGG + Exonic
1070920520 10:80182684-80182706 GGGAATGGGAGGCCAAGGGAGGG - Intronic
1070990733 10:80730056-80730078 TGGAAGAGGTGGCCAATGGGCGG + Intergenic
1072484276 10:95839825-95839847 GGGAAGGGGAGGCCAACAGTGGG + Intronic
1074143966 10:110700518-110700540 TGGAGGCAGAGGCCTAGGTTTGG + Intronic
1074755637 10:116622109-116622131 TGGAAGGAGAGGCCAAGAGTGGG - Intronic
1075048821 10:119166636-119166658 TGGAGGCGCAGGGCAAGGGAAGG - Intergenic
1075067938 10:119302355-119302377 TGGCAGAGGAGCCCAAGGGCAGG + Intronic
1075085020 10:119409128-119409150 TGGAAGCCGAGGCCCAGGTTGGG - Intronic
1075530202 10:123222621-123222643 TGGAAGCTGAGGCCAAGAATTGG + Intergenic
1077124439 11:926145-926167 TGGGAGCGGAGGCCCGGGGCGGG + Intronic
1077412030 11:2408125-2408147 TGGCAGAGGGGGCCCAGGGTGGG - Intronic
1080611366 11:33906804-33906826 CGGAAGCTGAGGACAAAGGTTGG - Intergenic
1081767123 11:45619196-45619218 TGCAAGCAAAGGCCAAGGTTAGG + Intergenic
1084464682 11:69315300-69315322 GGGAAGAGGAGGACAAGGCTGGG + Intronic
1085121166 11:73968520-73968542 TGGGAGGGGAGGCCAAGTCTAGG - Intronic
1085138472 11:74117576-74117598 TGGAAACTGAGGGCAAGAGTGGG + Intronic
1085269398 11:75261466-75261488 TGGGAGTGGAGGCAAAGGATAGG - Intergenic
1086333063 11:85773126-85773148 TGGAAACTGAGGCCAAGGAAAGG - Intronic
1087023342 11:93624931-93624953 TGGGAGCTGAGGCCCAGGGGAGG - Intergenic
1088111706 11:106268660-106268682 TGGGAGTGGAGGGCAAGGGGAGG - Intergenic
1089260029 11:117217943-117217965 TGGAGGCGGAGGCAGAGGATGGG + Intronic
1089326999 11:117664107-117664129 TGGGAGAGGAGGCCAGGGGAGGG + Intronic
1091717462 12:2789369-2789391 TGGAAGCCCTGGCCAGGGGTGGG - Intergenic
1091821507 12:3479000-3479022 AGAAAGAGGAGGCCAAGGGGCGG + Intronic
1091932005 12:4403631-4403653 TGGGAGGGGAGACCAAGAGTGGG + Intergenic
1092988537 12:13871953-13871975 GGGAAGTGGAGGACTAGGGTAGG - Intronic
1096503767 12:52080682-52080704 AGGAAGCTGAGGCCAAAGGCTGG - Intergenic
1096818784 12:54217954-54217976 TGCGAGCGGAGTCAAAGGGTGGG - Intergenic
1096978289 12:55713099-55713121 TGGAAGAGAAGGACATGGGTTGG - Intronic
1096992636 12:55817728-55817750 TGGAGGCGGAGGCCGCGGGTGGG - Exonic
1097276953 12:57820255-57820277 GGGAAGAGGAGGCCAGAGGTCGG - Exonic
1097758488 12:63434061-63434083 TGGGAGGGGAGGCCAAGGGTTGG + Intergenic
1098161493 12:67650181-67650203 AGGAAGAGGAGGTCATGGGTGGG - Intronic
1098511160 12:71315540-71315562 TTGAAGAGGAGGCCAGAGGTTGG - Intronic
1099024567 12:77448736-77448758 TGGAAGCCCAGGCCTAGAGTCGG - Intergenic
1099640541 12:85279434-85279456 TGGACGCGGTGGCGATGGGTGGG - Intergenic
1101718320 12:107330574-107330596 TGGAAACTGAGGCCCAGAGTGGG + Intronic
1102252593 12:111397430-111397452 TGGAAGCGGGGGTCTGGGGTTGG + Intergenic
1102821895 12:115915651-115915673 GGTAAGCTGAGGCCCAGGGTGGG - Intergenic
1103624078 12:122205474-122205496 TGGCAGTGGAGGTCAAGGGGAGG + Intronic
1103624199 12:122206108-122206130 TGGCAGAGGAGGGCAAGGGCTGG + Intronic
1104001448 12:124863343-124863365 TGGAGGCGCAGGCCAGGGTTGGG - Intronic
1105462847 13:20608029-20608051 GGGAAGAGGAGGCCATTGGTGGG - Intronic
1106337445 13:28796596-28796618 AGAAAGCGGCGGCCAAGGGGTGG - Intergenic
1107416304 13:40204134-40204156 TGGAAGGGTAGGCTAAAGGTTGG + Intergenic
1110565218 13:76950961-76950983 TGGAAGCAAGGGCCAAGGCTGGG - Intronic
1112242072 13:97692314-97692336 TGGAGGTGGGGGCCAAGGGAGGG + Intergenic
1112731528 13:102368041-102368063 TGGCAGTCGAGGCCAAGGGAAGG - Intronic
1112991495 13:105519198-105519220 TGGAAGTGGAGCCTAAGGGGAGG + Intergenic
1113694249 13:112332781-112332803 TGGAGGGGGAGGCCAAGAGAGGG - Intergenic
1113923656 13:113928603-113928625 AGGAAACTGAGGCCAAGGGAGGG - Intergenic
1114712706 14:24794631-24794653 GGGAAGCGCAGGACAGGGGTGGG + Intergenic
1116898571 14:50340485-50340507 TGGAGGCGGAGGGGAAGGGCAGG - Intronic
1117262750 14:54053440-54053462 TTGATGCTGAGGGCAAGGGTGGG - Intergenic
1118030409 14:61812823-61812845 CGGCCGCGGAGGCCAGGGGTGGG + Intergenic
1119218514 14:72887733-72887755 TGGAAGCGGAGCTCAAGGCTTGG + Intronic
1119264119 14:73254085-73254107 TGGAAGCTGTGGCCAAGGCTGGG + Intronic
1119415300 14:74465725-74465747 TGAAAGATGAGGCCCAGGGTTGG - Intergenic
1119483493 14:74974205-74974227 TGGAGACAGAGGCCCAGGGTTGG - Intergenic
1119743967 14:77031297-77031319 TGGAAGGGGAGGCTGGGGGTTGG - Intergenic
1122302054 14:100736953-100736975 TGGGATCGGAGGGGAAGGGTGGG - Exonic
1122806848 14:104264180-104264202 GGGAAACTGAGGCCCAGGGTGGG + Intergenic
1125442610 15:39719100-39719122 TGAAAGCAGAGGCCAAGAGGGGG + Intronic
1125595307 15:40881595-40881617 GAGAAGCGGAGGCCAAGTCTGGG - Intergenic
1125768704 15:42151345-42151367 TGGAAGATGAGGCCCAGGCTGGG + Intronic
1127651631 15:61014195-61014217 TGGAAGCTGAGGCCGAGAGAGGG - Intronic
1128529309 15:68432888-68432910 AGGAAGCCGAGGCAGAGGGTAGG + Intergenic
1129191713 15:73941448-73941470 TGGAAGATGAGGCCAAGGAGGGG - Intronic
1130967049 15:88705410-88705432 GGGAAGAGGAGGCAAAGGGTGGG + Intergenic
1131052999 15:89360328-89360350 TGGGAGCGGAGGGGAAGGGAGGG + Intergenic
1132584175 16:699116-699138 AGGAAACTGAGGCCAAGGCTGGG + Intronic
1132724156 16:1331672-1331694 GGGAAACGGAGGCCCAGGGCTGG + Intergenic
1132981217 16:2739534-2739556 GGGGAGCTGAGGCCAAGGGAAGG - Intergenic
1132989021 16:2783628-2783650 TGGAAGGGGACCCCAAGGGTGGG + Intergenic
1133231173 16:4367255-4367277 TGGAGGCGGAGGCGGAGGGTAGG + Intronic
1133802831 16:9097982-9098004 AGGAAGGGGAGGACAAGGATTGG + Intronic
1134260541 16:12647763-12647785 TTGGAGGGGAGCCCAAGGGTGGG - Intergenic
1134647543 16:15882116-15882138 TGAAGGCAGGGGCCAAGGGTGGG - Intronic
1136128205 16:28200774-28200796 AGGACGCTGAGGCCCAGGGTGGG - Intronic
1137479093 16:48836399-48836421 TGCATGTGGAGGCCAAGGCTCGG + Intergenic
1139825812 16:69756373-69756395 TGGAGGCAGAGGACAAGGGAGGG - Intergenic
1140486521 16:75297870-75297892 TGGAAGCAGAGGACAAGAGAAGG + Intronic
1141170046 16:81685251-81685273 AGGAAGCGGAGCCCCAGGCTGGG + Intronic
1141211494 16:81984816-81984838 GGTAAGAGGAGGGCAAGGGTTGG + Intergenic
1141750987 16:85957693-85957715 GGGAAGATGAGGCCAAGGGGAGG - Intergenic
1142128342 16:88421129-88421151 TGGGAGCAGCGGCCAGGGGTGGG + Intergenic
1142476862 17:193914-193936 TGGAAACGGAGGCCGAGAGGCGG + Intergenic
1142547991 17:718839-718861 TTTAAGCTGAAGCCAAGGGTTGG + Intronic
1142882772 17:2894493-2894515 TGGAAGCTGAGGCCACGGGAGGG - Intronic
1143344294 17:6238661-6238683 TGGAAACGGAGGCACAGGGAGGG + Intergenic
1144328970 17:14207231-14207253 TGGCAGCGGAGGGAAAGGGGCGG - Exonic
1144952520 17:19001910-19001932 GGGAAACTGAGGCCATGGGTAGG - Intronic
1145413880 17:22696112-22696134 TGGAAGCAGAGACCAAGTATGGG - Intergenic
1145414279 17:22702647-22702669 TGGAAGCAGAGACCAAGTATGGG + Intergenic
1146173541 17:30650455-30650477 TGGCAGGTGAGGCCAAGGGGAGG + Intergenic
1146642333 17:34550667-34550689 TGGAAACTGAGGCCTAGGGAGGG + Intergenic
1146649448 17:34597705-34597727 AGGAAGCAGAGGCCAAAGGTAGG + Intronic
1147596731 17:41722800-41722822 TGGAAGAGGAAGCCAGGGGCAGG + Exonic
1147596867 17:41723334-41723356 TGGAAGAGGAAGCCAGGGGCAGG + Exonic
1148684724 17:49495162-49495184 GGGAAGCAGAGGCAAAGGGAGGG - Intergenic
1148758671 17:49987936-49987958 AGGAAGGGGAGGTCAGGGGTGGG + Intergenic
1149571012 17:57672364-57672386 TGGGAGCGGTTGCCAAGGATGGG + Intronic
1149571933 17:57678294-57678316 GGGAAGTGGAGGCGAGGGGTGGG - Intronic
1151009182 17:70473347-70473369 TGGCAGTGCAGGCCCAGGGTAGG - Intergenic
1151365235 17:73612480-73612502 TAGAAGAGGAGGCCAAGGGAAGG + Intronic
1152354657 17:79800977-79800999 TAGAGGCTGGGGCCAAGGGTAGG - Intronic
1152793224 17:82293219-82293241 GGGAAGAGGAGGGCAAGGGGAGG + Intergenic
1155320391 18:24613108-24613130 TGGAAGCTGAGGCCTAGGGCTGG - Intergenic
1156243405 18:35274562-35274584 TGGAATCAGAGACTAAGGGTTGG - Intronic
1157339071 18:46763053-46763075 GGGAAGGGGAGGCCAAGGGAAGG - Intergenic
1158966332 18:62625300-62625322 TGGAAACAGAGTCCTAGGGTTGG - Intergenic
1160417166 18:78719544-78719566 TGGAAGAGGAGGAGAAGGTTGGG - Intergenic
1160442912 18:78906155-78906177 GGGAAGCTCAGGCCTAGGGTGGG - Intergenic
1160508096 18:79438375-79438397 TGGAGGTGGAGGCCGAGGGCCGG - Intronic
1160819749 19:1052450-1052472 TGGAAGGGGAGGCGAAGGGGAGG + Intronic
1160868984 19:1268480-1268502 TGGGAGGGGAGGCCGAGGGCCGG + Intronic
1161313904 19:3609054-3609076 TGGAGGTGGGGGCCAGGGGTAGG - Intergenic
1162464190 19:10830748-10830770 GGGAAGCTGAGGCCCAGGGAGGG + Intronic
1162584040 19:11548216-11548238 TGGAAACTGAGGCCCAGAGTGGG - Intronic
1162988881 19:14289610-14289632 TGGCAGGTGAGGCCAAGGGGAGG - Intergenic
1162998454 19:14351054-14351076 TGGAAGAGGTGGCCATGGGTTGG + Intergenic
1163085780 19:14979229-14979251 TGTGTGCGGAGGCCACGGGTTGG + Intronic
1164629282 19:29751348-29751370 TGAAAGTGGAGCCCAAGGCTGGG + Intergenic
1164730603 19:30501288-30501310 TGGAAAAGGAAGCCAAGGTTTGG + Intronic
1165120562 19:33556136-33556158 TGGGTCTGGAGGCCAAGGGTGGG - Intergenic
1165386757 19:35514408-35514430 TGGGAGGGAAGGCCAAGGGAGGG + Intergenic
1166524952 19:43504876-43504898 CGGATGCCGAGGCCACGGGTGGG - Exonic
1167417892 19:49386740-49386762 TGGACGCGGAGGGGAAGGGAGGG + Intergenic
1167649151 19:50719947-50719969 TGGTGGGGGAGGGCAAGGGTAGG - Intergenic
1168094625 19:54107649-54107671 TGGAAGGGAAGGCCCAGTGTGGG - Intronic
1168432959 19:56295844-56295866 TGGAAGAGGAGGCCACATGTAGG - Intronic
1168680972 19:58315690-58315712 GGGAAGGGGAGGCCATGGGTGGG + Intergenic
925077194 2:1026803-1026825 AGGAAGGGCAGGCCAAGGGCAGG - Intronic
925361427 2:3283164-3283186 TGGCAGTGGGAGCCAAGGGTTGG - Intronic
926337437 2:11875116-11875138 TGGGGGCGGAGGGGAAGGGTGGG - Intergenic
926337447 2:11875135-11875157 TGGGGGCGGAGGGGAAGGGTGGG - Intergenic
926819589 2:16838149-16838171 TGGAGGTGGTGGCCAAGTGTGGG - Intergenic
927075264 2:19571195-19571217 AGGAACCAGAGGCCAAGGGCTGG + Intergenic
929075686 2:38077094-38077116 CGGAGGCGGCGGCCGAGGGTGGG + Intronic
929079847 2:38111354-38111376 GGGAAGTGGGGGCCAAGGGAAGG - Intergenic
932330128 2:70894063-70894085 GAGAAGCGGAGGCAAAGGGAGGG + Intergenic
934163980 2:89277700-89277722 TGGGAGCTGAGGCCAGGGGAGGG + Intergenic
934203294 2:89904824-89904846 TGGGAGCTGAGGCCAGGGGAGGG - Intergenic
935199985 2:100848097-100848119 AGGAAGCAGAGGCCCAGGGAAGG + Intronic
935361580 2:102250649-102250671 AGGCAGCGGAGGCCGAGGGTGGG + Intergenic
940787800 2:158001083-158001105 TGGAAACTGAGGCCCATGGTAGG - Intronic
940804347 2:158169199-158169221 TTGAAGCAGAGCACAAGGGTTGG + Intergenic
942279021 2:174342529-174342551 TGGAAGAGGAGGGAAAGGGGCGG - Intergenic
943318182 2:186414227-186414249 TGGCAGCGTAGGTCAGGGGTAGG + Intergenic
943763702 2:191637362-191637384 TGGAAGACGAAGCCAACGGTGGG + Intergenic
946186481 2:217983524-217983546 TGGGAGCTGGGGCCAAGGGCTGG - Intronic
946193706 2:218021235-218021257 GGGAAACGGAGGCCCAGGCTTGG + Intergenic
946290110 2:218738189-218738211 TGGATGAGGAGGCCATGGGCTGG - Exonic
947619215 2:231577887-231577909 AGGAATCGGAGACCCAGGGTGGG - Intergenic
948408281 2:237739359-237739381 TGGAAGAGGAGGATAAGGGAAGG - Intronic
948835575 2:240624563-240624585 TGGAAACGGACGCCCAGGGAAGG - Intronic
1170053429 20:12172288-12172310 TGGAAGCAGAGGCCAAATTTAGG + Intergenic
1172037812 20:32022332-32022354 TGGAAACGGAGGCCCAGTGAGGG - Intronic
1173201217 20:40956624-40956646 AGGAAGCTGAGGCCAAGAGAGGG + Intergenic
1173318763 20:41968822-41968844 AGGAAGCAGAGGCCCAGGGAAGG - Intergenic
1173371163 20:42437344-42437366 TGGAAACTGAGGCCCAGGTTGGG + Intronic
1174372593 20:50102741-50102763 TGCAACGGGAGGCCAAGAGTAGG - Intronic
1175482738 20:59322787-59322809 AGGAAGCAGAGGCGAAGTGTGGG - Intronic
1175586916 20:60148530-60148552 GAGATGCAGAGGCCAAGGGTTGG + Intergenic
1175778436 20:61667304-61667326 TGCATGCGGAGCCCCAGGGTGGG - Intronic
1175784264 20:61702314-61702336 TGGAATCGGGGGCCCAGGATGGG + Intronic
1175935986 20:62514244-62514266 GGGAAGCTGAGGCCAGGGGAGGG + Intergenic
1176084935 20:63291540-63291562 TGCAAGAGGTGGCCATGGGTGGG + Intergenic
1176422959 21:6531075-6531097 TGGAAACAGGGGCCATGGGTTGG + Intergenic
1178078367 21:29034554-29034576 GGGAGGCTGAGGCCAGGGGTGGG - Intronic
1178506440 21:33166915-33166937 TGGAAGCACAGGCCAAGGAATGG + Intronic
1178905404 21:36632215-36632237 TGGAATGGGAGGCAGAGGGTGGG - Intergenic
1179698453 21:43139392-43139414 TGGAAACAGGGGCCATGGGTTGG + Intergenic
1181466712 22:23114355-23114377 AGGAAACTGAGGCCCAGGGTGGG + Intronic
1181468482 22:23123547-23123569 AGGAGGCAGAGGCCAAGGGGTGG - Exonic
1181611008 22:24011761-24011783 TGGAAACTGAGGCCGCGGGTAGG + Intronic
1182095092 22:27620693-27620715 AGGTAGAGGAGGCCAAGGGGAGG - Intergenic
1182487686 22:30649150-30649172 TGGAAGCTGAGGCCTAGGGAAGG - Intronic
1183064311 22:35352923-35352945 GGGAAGTGGAGGCCCAGGGAGGG + Intergenic
1183161557 22:36117068-36117090 TGGAGGCTGAGGCCAAGGAAGGG - Intergenic
1183191240 22:36323249-36323271 AGGAAGCTGAGGCCAAGGGAGGG + Intronic
1183210709 22:36449628-36449650 TGGAAGCTGAGGCCCAGAGATGG - Intergenic
1184031852 22:41899877-41899899 TGGAAGGGGAGGCTAGGGATGGG - Intronic
1184759170 22:46535279-46535301 TGGAAGGGGAAGTCAGGGGTGGG + Exonic
1185012910 22:48325783-48325805 TGAAGACGGAGGCCAAGGCTGGG + Intergenic
1185028982 22:48431832-48431854 TGGAGGTGGAGCCAAAGGGTGGG - Intergenic
1185145992 22:49137015-49137037 TGGCAGCGGGGGCCATGGGGTGG - Intergenic
949641424 3:6039353-6039375 TGGATTCATAGGCCAAGGGTAGG + Intergenic
950433013 3:12962049-12962071 TGGAAACTGAGGCCCAGGGAGGG + Intronic
950568478 3:13785874-13785896 GGGAAGCTGAGGCCCAGGGAGGG + Intergenic
953786743 3:45916885-45916907 TGGCAGAGGAGGGAAAGGGTGGG - Intergenic
954404972 3:50340642-50340664 TGGAAGCGGTGGCCACGGCCAGG + Exonic
954681695 3:52349532-52349554 TGGATGCCCAGGCCAAGGGAAGG + Intronic
954912336 3:54121124-54121146 AGGATGCTGAGGCCAAGGGCGGG + Intergenic
955344210 3:58149143-58149165 GGGAAGCTGAGAACAAGGGTGGG - Intronic
956122291 3:65978435-65978457 TGGAAGAGAAGGCCAGGGGAGGG + Intronic
961330284 3:126134332-126134354 TGGCAGCAGAGGCCAAGGGAGGG + Intronic
967399210 3:189041747-189041769 TTCAAGTGGAGGCGAAGGGTTGG + Intronic
968523221 4:1043889-1043911 TGGAAGGGGAGGCCCTGGGCTGG - Intergenic
968653200 4:1767948-1767970 TGGAAGCCGGGGCCTGGGGTGGG - Intergenic
969481936 4:7451363-7451385 GGGAAACTGAGGCCAAGGGAGGG - Intronic
972338354 4:38128637-38128659 TGGAAGAGGTGGCCAAGGACAGG + Intronic
973907471 4:55546410-55546432 GGGGGGCGGCGGCCAAGGGTGGG - Intronic
973983197 4:56323993-56324015 TGGAAGCAGAGGTCAGGGGCTGG + Intronic
974919556 4:68222076-68222098 TGGAAGTGGAGGCAGAGAGTTGG + Intergenic
976060505 4:81122871-81122893 TGGAAAGGGTGGCCTAGGGTGGG - Intronic
977175446 4:93814724-93814746 TGGAGGCGGAGCCTAATGGTAGG + Intergenic
980794397 4:137662182-137662204 TGGAAGCAGAGGTAAAGGCTTGG - Intergenic
984856393 4:184199580-184199602 TGGAAGGAGAGCCCAAGGCTTGG + Intronic
985552395 5:540345-540367 TGGGAGGGGAGGCCAGGGCTTGG - Intergenic
986032629 5:3908592-3908614 TGGAAGGAGAGGCCAAGGAGGGG - Intergenic
986402281 5:7394245-7394267 TGGAGGAGGAGGCAATGGGTGGG - Intergenic
993903408 5:93599053-93599075 TAGAAGAGAAGGCCAGGGGTGGG - Intergenic
997903478 5:137790571-137790593 TGTAAGAAGAGGCCAAGGCTGGG - Intergenic
998041107 5:138951537-138951559 GGTAAACAGAGGCCAAGGGTGGG + Intronic
998295123 5:140962112-140962134 GGGAGGCCGAGGCCAAGGTTAGG - Intronic
1001416217 5:171546217-171546239 TGGAAGAGGAGACCAGGGTTTGG + Intergenic
1002334098 5:178466193-178466215 TGGAAGTGGAGGCCGAGAGGAGG - Intronic
1002554521 5:180025051-180025073 TGGAAGTGGAGGACAAGGCAGGG - Intronic
1002578406 5:180191900-180191922 TGGAAGAGGATGCCCAGGCTAGG - Intronic
1005650005 6:27877743-27877765 AGGAAGAGGAGGCCAGAGGTCGG - Intergenic
1006603835 6:35242812-35242834 TGGAAGGGGAGGGCAGAGGTGGG + Intronic
1006904457 6:37523635-37523657 GGGAAGAGGAGGCCAGGGTTGGG + Intergenic
1006905753 6:37532315-37532337 TGGAAACTGAGGCCAATGGAGGG - Intergenic
1008669311 6:53750699-53750721 TGGAAGTGGAGGTCAGGGGAGGG + Intergenic
1012062967 6:94511487-94511509 GGGAAGCGGGGGCCGGGGGTGGG - Intergenic
1013225814 6:108118727-108118749 TGTATGGGGAGGCCAGGGGTGGG - Intronic
1015146919 6:129997301-129997323 GGGATGGAGAGGCCAAGGGTGGG + Intergenic
1017823410 6:158064734-158064756 TGGAAGGGAAGGCCAAGGTAGGG + Exonic
1018013435 6:159692656-159692678 AGGAGGCGTTGGCCAAGGGTAGG - Exonic
1019170500 6:170130858-170130880 GGCAAGTGGAGGCCCAGGGTAGG - Intergenic
1019552832 7:1611753-1611775 TGGAACAAGAGGCCAAGGGAAGG - Intergenic
1020046730 7:5046111-5046133 TGGCGGCGGAGGCGAAGGGGCGG + Exonic
1020292100 7:6730038-6730060 CGGAGGCGGAGGCGAAGGGGCGG + Intergenic
1023017835 7:35984222-35984244 TGGGAGGTGAGGCCAAGCGTGGG - Intergenic
1023386372 7:39662002-39662024 TGGAAGCAGCTGCCAAGGCTTGG + Intronic
1023858510 7:44201340-44201362 GGGTGGAGGAGGCCAAGGGTAGG + Intronic
1024208313 7:47182624-47182646 TGGAACCCCAGGCCAGGGGTGGG + Intergenic
1025623733 7:63198901-63198923 AGGAAGAGAAGGGCAAGGGTTGG + Intergenic
1027121869 7:75527831-75527853 TGGCGGCGGAGGCGAAGGGGCGG - Intergenic
1027400303 7:77799276-77799298 TGGAAGCGGGGCCCGAGGGGCGG - Intronic
1028205388 7:88010800-88010822 TAGTAGCTGAGGCCAAGGCTTGG + Intronic
1029107001 7:98185855-98185877 AGAAAGCGGAGGTCAAGGCTGGG - Intronic
1029260513 7:99299507-99299529 TAGAGGCAGAGGCCAAGGGCCGG + Intergenic
1029423962 7:100485358-100485380 AGGAAGAGGAGGCCAAGAGGAGG + Exonic
1029459715 7:100687730-100687752 TGGGAGGGGAGGCCATGGGTTGG - Intronic
1029968176 7:104762468-104762490 CGGAAGAGGAGACCAAGGGCAGG + Intronic
1030461390 7:109840276-109840298 GGGAAGAGGAGGCCAGAGGTCGG + Intergenic
1030922868 7:115414454-115414476 TAGGAGCGTAGGCCTAGGGTAGG + Intergenic
1033171053 7:139084664-139084686 AGGAAACGGAGGCTAAGAGTAGG - Intronic
1034296581 7:149978195-149978217 TGGCAGCGGAGGCCAGGTCTTGG + Intergenic
1034683991 7:152953771-152953793 TGTAAGCTCTGGCCAAGGGTAGG + Intergenic
1034809450 7:154118636-154118658 TGGCAGCGGAGGCCAGGTCTTGG - Intronic
1034966229 7:155392789-155392811 TGGAAGAGGAGGACTAGGGCAGG + Intronic
1036788220 8:11701871-11701893 TGGTAGGGGTGGCCCAGGGTTGG + Intronic
1037519283 8:19664023-19664045 TGAAAGCGCGGGCCAGGGGTAGG + Intronic
1037988567 8:23304814-23304836 GGGAACCTGAGGCCAAGGGCAGG - Intronic
1039473298 8:37826825-37826847 TGGAGGAGGAGGTCAGGGGTGGG - Intronic
1039542261 8:38382058-38382080 GGGAAGGGGAGGCCGAGGGACGG + Exonic
1039884364 8:41646882-41646904 TGGAAGAGGAAGCAAATGGTGGG - Intronic
1040610354 8:48977222-48977244 TGAGAGGGGAGGCCAAGAGTTGG - Intergenic
1041935301 8:63326211-63326233 TGGAAGGGGAGGAGAAGGGCAGG + Intergenic
1042875265 8:73435551-73435573 TGGCCGCAGAGCCCAAGGGTGGG - Intronic
1044511898 8:93091316-93091338 TGGAAGTAGAGGTGAAGGGTGGG - Intergenic
1045535807 8:103026564-103026586 GGGAAGCGGAGGCAAAGGGCGGG + Intronic
1045781088 8:105864554-105864576 TGGAAGTGGGGAGCAAGGGTTGG - Intergenic
1046225067 8:111267655-111267677 TGGAAGGGGAGGGCATGGGAGGG - Intergenic
1048396605 8:134020022-134020044 TGGAAGCTGAGGCTTAGGGAAGG + Intergenic
1048575081 8:135683916-135683938 TAGCAGGGGAGGCCAAGGATGGG + Intergenic
1049483842 8:142841009-142841031 TGGAAGCAGAGGGGAAGGGCTGG + Intronic
1049632121 8:143664511-143664533 TGGAAGTGGAGTCCAAGATTGGG - Intergenic
1053449442 9:38180959-38180981 AGGGAGAGGTGGCCAAGGGTGGG - Intergenic
1056635322 9:88326785-88326807 TGGCAGCGGAAGCTGAGGGTGGG + Intergenic
1056765261 9:89441233-89441255 TGGAAGCGGAGGCCAAGGGTTGG - Intronic
1057128108 9:92635017-92635039 TGGGAGCGGAGGACTGGGGTAGG + Intronic
1057620336 9:96629040-96629062 TGGCAGCGGGGGCCAAAGGCAGG - Intergenic
1058665115 9:107306492-107306514 TGGAAGTGGGGGCCAAGGCAGGG - Exonic
1058918129 9:109587124-109587146 TGGCAGCAGGGGCAAAGGGTGGG + Intergenic
1059016808 9:110527023-110527045 TGGAGGCGGTGGCTATGGGTTGG + Intronic
1060160082 9:121354221-121354243 GGGAAGGGGAGGGGAAGGGTAGG + Intronic
1061123526 9:128659103-128659125 TGGAGGCAGAGGCCATGGGGTGG - Intergenic
1061661512 9:132133343-132133365 TGGAAGCTTACGCCAAGGGAGGG + Intergenic
1061872998 9:133530547-133530569 AGGAAGCTGAGGCCAAGGCTTGG - Intergenic
1062005897 9:134238249-134238271 GGGAAGCAGAGGCCAAGGGGAGG + Intergenic
1062287204 9:135778534-135778556 TGGAAGAGGAGGGGAGGGGTGGG - Intronic
1062324006 9:136003955-136003977 AGGTAGAGGAGGCCTAGGGTGGG - Intergenic
1188378582 X:29463915-29463937 TGGAAGTGGAGGCTAACTGTTGG - Intronic
1188653871 X:32666349-32666371 TGGGAGTGGAGGGCAAGGGTAGG - Intronic
1188836685 X:34966167-34966189 TGGTAGTGGAGGCCAGGGATGGG - Intergenic
1189034946 X:37486236-37486258 TGGTAGTGGAGGCCAGGGGTGGG + Intronic
1191599220 X:62984642-62984664 GGTAAGAGGAGGGCAAGGGTTGG - Intergenic
1192208202 X:69109976-69109998 TGGAAGGGGAGGGGAGGGGTGGG + Intergenic
1192458831 X:71300216-71300238 TGGAGGCAGAGGGCAAGGGAGGG + Exonic
1194573753 X:95585629-95585651 TGGAAGTGGAAGACAGGGGTAGG - Intergenic
1195344340 X:103934482-103934504 TGGGAGCGGGGGGCAAGGGGAGG - Intronic
1199921065 X:152404564-152404586 TGAAAGAGGAGGCCAAGTGAGGG + Intronic
1199997767 X:153037122-153037144 TGGAAGAAGTGGCCCAGGGTAGG + Intergenic