ID: 1056765262

View in Genome Browser
Species Human (GRCh38)
Location 9:89441237-89441259
Sequence TGTGTGGAAGCGGAGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765262_1056765271 -1 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765262_1056765267 -9 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765262_1056765273 20 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765273 9:89441280-89441302 GGCACTGTTCCTCCCAGCAGCGG No data
1056765262_1056765269 -5 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765262_1056765270 -4 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765262_1056765274 21 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765274 9:89441281-89441303 GCACTGTTCCTCCCAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765262 Original CRISPR TGTGTGGAAGCGGAGGCCAA GGG (reversed) Intronic
900932935 1:5748011-5748033 TGTGGGGAAAGGGAGGCCAGAGG - Intergenic
901186242 1:7375293-7375315 TGGTTGGAAGCTGAGGACAATGG - Intronic
902246760 1:15125905-15125927 TGTGGGGAAGAGGAGGTAAAAGG - Intergenic
902447670 1:16477236-16477258 GATGTGGAAACGGAGGCCCAGGG - Intergenic
904004654 1:27357426-27357448 TGTGCAGAAGCGCAGGCCCAAGG + Exonic
904013162 1:27401756-27401778 GGTGAGGAAGCTGAGGCCCAAGG + Intergenic
907575783 1:55524569-55524591 GGTGAGGAAACTGAGGCCAAAGG - Intergenic
907860224 1:58345738-58345760 GGTGAGGAAGCAGAGGCCAGAGG - Intronic
910803538 1:91167850-91167872 TGTGGGGAAGCCAAGGACAAGGG - Intergenic
911090121 1:94011238-94011260 TGGGTGGTAGCCGAGGCCCATGG - Intronic
913112974 1:115672454-115672476 TGTGTGGCTGCTGAGGCCCATGG - Intronic
913419354 1:118647986-118648008 AGTGTGGAAGGGGAGCCCAGCGG - Intergenic
914995054 1:152536206-152536228 AGTGTGGAAGCTGAGACCCAGGG - Intronic
915444195 1:155965574-155965596 AGTGTGGCAGTGGAGGCCAAGGG - Intronic
917965960 1:180178666-180178688 TGTGTGGAAGCGGAGGAGGGCGG + Intronic
919695096 1:200566709-200566731 ACTGTGGACGCTGAGGCCAAGGG - Intronic
921297591 1:213719296-213719318 TGTGAGGAACCGGAGTACAAGGG + Intergenic
921885521 1:220301047-220301069 TGTCTGGAAGGGGTGGCCACAGG + Intergenic
923216998 1:231857511-231857533 TGTGAGGAAACTGAGGCCCATGG - Intronic
923431679 1:233928121-233928143 TGTGAGGAAGCAGAGGGCTAGGG - Intronic
1063663821 10:8050409-8050431 GGGGAGGAAGTGGAGGCCAAAGG - Intergenic
1065145842 10:22767205-22767227 TGTTTCTCAGCGGAGGCCAATGG + Intergenic
1065248529 10:23785371-23785393 TGTGTGGATGCTGAGGCACAGGG - Intronic
1066982556 10:42431866-42431888 TGTGGGGAATCGGAGGCAAGGGG - Intergenic
1067101703 10:43338987-43339009 TGAGGGGAAGAGGAGGCCATGGG + Intergenic
1070920522 10:80182688-80182710 TATGGGGAATGGGAGGCCAAGGG - Intronic
1070990731 10:80730052-80730074 GGTCTGGAAGAGGTGGCCAATGG + Intergenic
1071821656 10:89286372-89286394 GGTGGGGGAGCGGAGGCTAAGGG - Intronic
1074009674 10:109465186-109465208 TGTGTGGAGGCTAAGGCCAAAGG + Intergenic
1075730422 10:124632226-124632248 GGTGTGGGAGCTGACGCCAAAGG + Intronic
1075960262 10:126562306-126562328 TGTATGGAAGCCAAGTCCAAAGG + Intronic
1076791047 10:132776896-132776918 TGTGTGAGGGCGGGGGCCAATGG + Intronic
1077439321 11:2560632-2560654 GGTGTGGAAGGGGAGGCTGAGGG - Intronic
1078095605 11:8294741-8294763 GGAGTGGAAGCAGAAGCCAAGGG - Intergenic
1079354552 11:19719328-19719350 TGTGAGAAAGCAGAGGCCAAGGG + Intronic
1080684964 11:34507570-34507592 TGTGTGCAAGCGGGGGCCCTAGG - Intronic
1082272271 11:50184256-50184278 AGTGTGGAAGGGGATGCCAGCGG - Intergenic
1083832735 11:65243305-65243327 TTTGGGGAAGCTGAGGCCAGAGG - Intergenic
1084193538 11:67509959-67509981 GGGGTGGAAGCGGAGACCGAGGG + Intergenic
1088877647 11:113949239-113949261 TGTGTGGCAGGGGTTGCCAAAGG + Intergenic
1089309645 11:117549170-117549192 TGTGTGCAGGAGGAGGCCATTGG - Intronic
1089377518 11:118005093-118005115 TGTGGGGAGGTGGAGGGCAAGGG - Intergenic
1091234488 11:134011692-134011714 TGTGAGGAAGCCCAGACCAAAGG - Intergenic
1091283761 11:134396914-134396936 GATGGGGAAGCTGAGGCCAAGGG - Intronic
1091821505 12:3478996-3479018 TGTGAGAAAGAGGAGGCCAAGGG + Intronic
1092101563 12:5888383-5888405 AGTGTGGAAGGGGACGCCAGCGG + Intronic
1097250969 12:57632195-57632217 TCTGAGGACGCGGGGGCCAAGGG - Intronic
1098511161 12:71315544-71315566 TCTGTTGAAGAGGAGGCCAGAGG - Intronic
1100030670 12:90186374-90186396 TATGTGGAAAAGGAGGACAATGG - Intergenic
1101945587 12:109134068-109134090 TGTGTGTAAGCTGGGGGCAATGG - Intronic
1102655505 12:114479667-114479689 TGTGGGGAAGGGGACGCCCAGGG - Intergenic
1103561230 12:121794153-121794175 TGTGGGGAAGCTGAGGCCAGAGG - Exonic
1104710801 12:130984533-130984555 TGTGTAGAGGCGGAGGGTAATGG - Intronic
1104725798 12:131074986-131075008 CGTGTGGAAGCGCAGTCCCAAGG - Intronic
1104920424 12:132287732-132287754 TGTGTGGAATGGGTGCCCAAGGG + Intronic
1104933479 12:132352551-132352573 AGTGTGGAAGCGAAGGACCACGG + Intergenic
1104991034 12:132624002-132624024 TGTGTGGAGGTGAAGGACAAGGG + Exonic
1108813300 13:54257641-54257663 AGTGTGGAAGTGGAGGAGAAGGG - Intergenic
1109298198 13:60561459-60561481 AGTGAGGAAGAGGAAGCCAAAGG + Intronic
1110244808 13:73310844-73310866 TGTGTGGGAGCGGAGGGCTCAGG - Intergenic
1111009540 13:82293397-82293419 TGTGGGGAAGGGAAGGCCAGTGG + Intergenic
1113197325 13:107823576-107823598 GGAGTGGGAGCGGAGGCCACGGG - Intronic
1115434754 14:33360062-33360084 TGTGTGTCAGCGGAGGCCAGTGG - Intronic
1117496486 14:56310588-56310610 GGTCGGGAAGGGGAGGCCAATGG - Intergenic
1117623277 14:57609833-57609855 TGTGGGGAAGCGGAGGGGCAAGG - Intronic
1119101691 14:71885795-71885817 TGGGTGAAAGAGAAGGCCAAAGG - Intergenic
1119252245 14:73166686-73166708 TATATGGAAGGTGAGGCCAACGG - Intronic
1119274380 14:73340293-73340315 GGTGGGGAAGCTGAGGCCCATGG - Intronic
1120536381 14:85701154-85701176 GGTGTGGAACCGGGGGCCACTGG - Intergenic
1120901378 14:89578690-89578712 TGTTTGGAAGCAGAGGCAACAGG - Intronic
1122047506 14:99034486-99034508 AGAGGGGAAGCGGAGGACAAAGG + Intergenic
1122369686 14:101222556-101222578 TCTGGGGAAGCAGAGGCCGAGGG - Intergenic
1122487331 14:102089848-102089870 TGTGTGGAAGCGGGGGATGAAGG - Intronic
1123942207 15:25222011-25222033 TTTGTGGCAGGGAAGGCCAAGGG + Intergenic
1128683266 15:69666487-69666509 GATGTGGAAACGGAGGCCCAGGG + Intergenic
1129311018 15:74708995-74709017 TGTGTGGTAGTGGAGGCAGACGG - Intergenic
1131671446 15:94624057-94624079 TGTGTTAAAGCAGAAGCCAAAGG + Intergenic
1132230584 15:100181081-100181103 TGTGTGGTGGCGGTGGCCACAGG - Intronic
1132677063 16:1125208-1125230 TTTGGGGAAGCTGAGGCCTATGG + Intergenic
1132867385 16:2100198-2100220 TCGGTGGAGACGGAGGCCAACGG - Exonic
1133438470 16:5800567-5800589 TGTGTGGAATTGGAGGACACGGG + Intergenic
1134248352 16:12556682-12556704 TGTCTGGAGGCAGAAGCCAAAGG + Intronic
1134524392 16:14932917-14932939 TCGGTGGAGACGGAGGCCAACGG + Intronic
1134548509 16:15128024-15128046 TCGGTGGAGACGGAGGCCAACGG - Intronic
1134711980 16:16331404-16331426 TCGGTGGAGACGGAGGCCAACGG + Intergenic
1134719838 16:16374697-16374719 TCGGTGGAGACGGAGGCCAACGG + Intergenic
1134947588 16:18337188-18337210 TCGGTGGAGACGGAGGCCAACGG - Intergenic
1134954848 16:18377290-18377312 TCGGTGGAGACGGAGGCCAACGG - Intergenic
1137621492 16:49879405-49879427 TATGTGGCAGTGGAGGCCATTGG - Intergenic
1138231924 16:55344061-55344083 GGTGAGGAAGCTGAGGCCCATGG + Intergenic
1138280411 16:55768635-55768657 TGTGTGAAGGCTGAGCCCAAGGG - Intergenic
1139492369 16:67293224-67293246 TGTTTGGAAGCGCAGGGCATGGG - Intronic
1139779635 16:69339914-69339936 TGTGTGGGTGTGGTGGCCAAGGG + Intronic
1142015674 16:87745490-87745512 TGTGTGGAAGATGATGCCACAGG - Intronic
1143354050 17:6311620-6311642 TGTTAGGAAGCTGAGGCAAAAGG + Intergenic
1143569226 17:7744363-7744385 TGTGTGGAGACGGAGTCCCAGGG + Intronic
1145807848 17:27747160-27747182 TGGGAGGTAGGGGAGGCCAAGGG - Intergenic
1147985839 17:44307666-44307688 TGAGAGGAATAGGAGGCCAAGGG + Intergenic
1148021476 17:44556759-44556781 TGTGTGGAGGGGGAGGGCGAGGG + Intergenic
1149897788 17:60442996-60443018 TGTGTGGCAGAGGAGGCGCATGG - Intergenic
1151365234 17:73612476-73612498 AGGGTAGAAGAGGAGGCCAAGGG + Intronic
1152690366 17:81715266-81715288 GGTGGGGAAGCTGAGGCCCAGGG + Intronic
1154299040 18:13176674-13176696 TGTGAGGAAACAGAGGCCACAGG + Intergenic
1155320392 18:24613112-24613134 TGGATGGAAGCTGAGGCCTAGGG - Intergenic
1155322023 18:24629063-24629085 TGTGGTGAAGGGGAGGTCAAAGG + Intergenic
1155824285 18:30419604-30419626 AGTGTGGAAGCCGACCCCAACGG - Intergenic
1157052031 18:44177496-44177518 TAGGTGGAAGCTGAGGACAAAGG - Intergenic
1157339072 18:46763057-46763079 TGGTGGGAAGGGGAGGCCAAGGG - Intergenic
1159230947 18:65606084-65606106 GGTGTGGAAGGGGACGCCAGCGG - Intergenic
1161886063 19:6996576-6996598 TGTGGGGAACTGGAGACCAAAGG + Intergenic
1162464188 19:10830744-10830766 GGTGGGGAAGCTGAGGCCCAGGG + Intronic
1163563091 19:18032492-18032514 TGTGTGCATGGGAAGGCCAAGGG - Intergenic
1165431037 19:35773076-35773098 TTTGAGGAAGCCCAGGCCAATGG - Intergenic
1168437073 19:56326838-56326860 TGTGTTGAAGAGGAAGCCACAGG - Intronic
926233843 2:11024597-11024619 TGTGGGGATGGGGCGGCCAAGGG - Intergenic
927376488 2:22421015-22421037 TGAGTGGAAGCTGATGCCCAGGG - Intergenic
930199549 2:48540076-48540098 TGTATGGAAGCTGAGGCCAAGGG - Intronic
934163978 2:89277696-89277718 TGGGTGGGAGCTGAGGCCAGGGG + Intergenic
934203296 2:89904828-89904850 TGGGTGGGAGCTGAGGCCAGGGG - Intergenic
937069972 2:119055757-119055779 TGTGAGGAAGCCCAGGCCACAGG - Intergenic
937855634 2:126670464-126670486 GCTGGGGAAGCAGAGGCCAAAGG - Intronic
937887010 2:126906884-126906906 AGTGTGGAAGCTGACACCAACGG + Intergenic
945124037 2:206488735-206488757 TGTGTGGAAGTGAATGCCAAGGG + Intronic
946290111 2:218738193-218738215 TCTGTGGATGAGGAGGCCATGGG - Exonic
947361392 2:229348960-229348982 TGGTGGGAAGAGGAGGCCAAAGG + Intergenic
948653880 2:239464989-239465011 TGTCTGGGGGCGGAGGACAATGG + Intergenic
1168840840 20:909121-909143 TGCGGGGAAACGGAGGCCCAGGG - Intronic
1169470180 20:5878317-5878339 TGTGTTGAAGCTGAGGCAATTGG + Intergenic
1170419613 20:16179861-16179883 TGTGAGGAAGCCCAGGCCAGTGG - Intergenic
1170736960 20:19021099-19021121 TGTGTGGAAAGAGAGGCCACAGG + Intergenic
1171077785 20:22146815-22146837 TGTGAGGGAGCGGAGGGGAAAGG + Intergenic
1173992577 20:47314721-47314743 TGTCTGGAAGTAGAGGCCATTGG - Intronic
1174408119 20:50316152-50316174 TATGTGGGAGGGGAGGCCAAGGG - Intergenic
1174411186 20:50337648-50337670 GGTGTGGAAACTGAGGCCCAAGG - Intergenic
1174796224 20:53524852-53524874 TGTGTTAAACCGGAGGCCACTGG - Intergenic
1175796318 20:61773436-61773458 TGTGTGGAAGCAGTGGGCAGGGG + Intronic
1175935984 20:62514240-62514262 GGTGGGGAAGCTGAGGCCAGGGG + Intergenic
1176021159 20:62963110-62963132 TGTCTGGTAGGGGAGGCCAAGGG + Intronic
1178947285 21:36959137-36959159 TGTGGGGAAGCGGGGGCCTCTGG - Intronic
1180069963 21:45431336-45431358 TGTGTGGACCCGGCGGCCCAGGG + Intronic
1181635352 22:24171934-24171956 TGTGTGGCCGGGGAGGCCCAGGG - Exonic
1181719632 22:24763837-24763859 GCTGTGGGAGCGGAGTCCAAAGG - Intronic
1183967658 22:41452292-41452314 TGCGTGGAAGGAGAGGCAAAGGG + Intergenic
1184578269 22:45392676-45392698 AGTGTGGATATGGAGGCCAATGG + Intronic
949563011 3:5220364-5220386 TGTGTGGGTGCAGAGGCCCATGG + Intergenic
950052400 3:10002614-10002636 TGGGTGGAGGGGGAGGCCACAGG - Intronic
950304513 3:11907786-11907808 TGGGTGGAAGGGGAGGCCATGGG - Intergenic
950304534 3:11907872-11907894 TGGGTGGAGGGGGAGGCCACAGG - Intergenic
950416351 3:12871014-12871036 TGAGTGGAGGGGGAGGCCACAGG - Intronic
950526698 3:13528649-13528671 TGGATGGAAGAGGAGGCCTAAGG + Intergenic
950661758 3:14471227-14471249 TGCCTGAAAGCGGATGCCAACGG - Intronic
952865246 3:37850869-37850891 TGTGAGGAAGCCCAGGCCACTGG + Intergenic
953040340 3:39250599-39250621 TGTGGGGAAGCAGAGGCATATGG + Intergenic
953931661 3:47008820-47008842 TGTGGCTAAGCGGAGGCCCAGGG - Intronic
954681694 3:52349528-52349550 TCTGTGGATGCCCAGGCCAAGGG + Intronic
954747430 3:52795101-52795123 GGTGGGGAAGCTGAGGCCCAGGG - Intronic
955190152 3:56754172-56754194 TGTGTGGAAGAGTAGGTAAATGG + Intronic
958961945 3:100519103-100519125 TGGGTGGAGGTGGAGGCCACCGG + Intronic
959084099 3:101833344-101833366 GGTGTGGAAGGGGAGGAGAAGGG - Intronic
961255796 3:125550914-125550936 TGCCTGGAGGTGGAGGCCAAAGG + Intronic
962468907 3:135687650-135687672 TGTGTGTTAGTGGAGGGCAAAGG + Intergenic
962890047 3:139663602-139663624 GGTGAGGAAGCTGAGGCCAGAGG - Intronic
965126856 3:164641674-164641696 TGAGTGGAAGGGGAGGCCAGTGG - Intergenic
973085400 4:46053556-46053578 TGTGTGGGAGATGAGGCAAAGGG - Intronic
976408307 4:84684330-84684352 TGAGTGGATGCAGTGGCCAAAGG + Intronic
976597885 4:86911181-86911203 TGTGGGGAAGTGGAGGCAGAAGG + Intronic
978593143 4:110348151-110348173 TTTGTGGGATCAGAGGCCAAAGG - Intergenic
979513124 4:121576308-121576330 TGTGAGGAAGCTGAGCCCCATGG - Intergenic
979562940 4:122120498-122120520 TGTGTGGAAGCTGAGATAAAGGG + Intergenic
980968262 4:139544833-139544855 TGTGTGGAGGGGGAGGCGGAGGG + Intronic
984775968 4:183482211-183482233 AGTGTGGAAGCGGACCCCAGCGG + Intergenic
987535056 5:19175166-19175188 TGTGGGGAAGAGGATGACAAGGG + Intergenic
989741540 5:44779232-44779254 TGTGTGGAAGGGAAGGGGAAAGG + Intergenic
989814911 5:45724239-45724261 TATGCGGAAGGGGAGGCAAAGGG + Intergenic
991044092 5:62204949-62204971 TGCATGGAAGCAGAGGCCACCGG - Intergenic
991120500 5:63008227-63008249 AGAGCGGACGCGGAGGCCAAGGG - Intergenic
992107043 5:73458117-73458139 TGTGAGGAAGCCCAGGCCACCGG - Intergenic
992636035 5:78726808-78726830 TGTGTGAAAGCTAAGACCAAGGG - Intronic
999041468 5:148417903-148417925 TGTGTGCAAGAGTAGGCAAATGG - Intronic
999830853 5:155318039-155318061 TGAGTGGATAAGGAGGCCAAGGG - Intergenic
1000157484 5:158565941-158565963 TGTGAGGAAGAGAAGGCCAAGGG - Intergenic
1001690393 5:173628614-173628636 TGTGTGGGTCCCGAGGCCAAGGG - Intergenic
1002107085 5:176885071-176885093 AGTGGGGAAGGGGAGGCAAAGGG + Intronic
1002568699 5:180128247-180128269 CTTGTGGATGCAGAGGCCAAGGG - Intronic
1002800145 6:514758-514780 TGTGTGGGGGAGGAGCCCAAAGG + Intronic
1003018772 6:2491922-2491944 TGTATGGAAGCGGAGGCATCAGG + Intergenic
1003397432 6:5765211-5765233 TGTGTGGAAGCCGAGAGCCAGGG - Intronic
1006404213 6:33834772-33834794 TGTGGGGAGGCGCTGGCCAAGGG - Intergenic
1006575726 6:35044148-35044170 TGTGTGGAAGCAGAAGACCATGG + Intronic
1006905755 6:37532319-37532341 GATGTGGAAACTGAGGCCAATGG - Intergenic
1010199174 6:73268435-73268457 GGTGTGGAAGGGGACCCCAACGG + Intronic
1013554770 6:111245155-111245177 TGTGTGGAAGTGGATGCTAAAGG - Intergenic
1016388084 6:143548524-143548546 TGTGTGGAATTGGATTCCAAGGG - Intronic
1016748116 6:147602890-147602912 TGTGTGGTTGCGGAGGCTGAGGG + Intronic
1019477813 7:1252396-1252418 TGTGTGGACACGGAGCCCAGAGG - Intergenic
1020150252 7:5676514-5676536 TGTGAGGAAGCAGAGGCCACTGG - Intronic
1026167397 7:67922487-67922509 TTTGGGGAAGCTGAGGCCAGTGG + Intergenic
1026909973 7:74085763-74085785 TGTGTGCAAGCTGCGGCCAGAGG + Exonic
1029580983 7:101436424-101436446 AGTGAGGAAGTGGAGGCCAGGGG + Intronic
1032399811 7:131616941-131616963 AGTGAGGAAGCGGAAGCCAGAGG + Intergenic
1034119028 7:148610490-148610512 TGTCTGGAAGCTGAGGAGAAAGG - Intronic
1034966228 7:155392785-155392807 TGTCTGGAAGAGGAGGACTAGGG + Intronic
1035296828 7:157872203-157872225 TGTGTGTATGCGGAGGACACTGG - Intronic
1035529886 8:342859-342881 TGAGTGGGATTGGAGGCCAAGGG - Intergenic
1036851185 8:12202946-12202968 AGTGTGGAAACGGACCCCAATGG + Intergenic
1036872549 8:12445220-12445242 AGTGTGGAAACGGACCCCAATGG + Intergenic
1037889461 8:22615873-22615895 TGTGGAGGATCGGAGGCCAAAGG + Exonic
1039232030 8:35459016-35459038 TGTGTGGGAGTGGAGGTCAAGGG - Intronic
1043378208 8:79673634-79673656 TCTGAGGAAACAGAGGCCAAAGG - Intergenic
1044511900 8:93091320-93091342 TGTGTGGAAGTAGAGGTGAAGGG - Intergenic
1046769583 8:118105063-118105085 GGTGTGTAAACGGAGGCAAACGG - Intronic
1047907976 8:129493177-129493199 TGTGTGGGAGGGGAGGACAAAGG + Intergenic
1052294104 9:26878610-26878632 TGTGTGGAAGTGGAGGAAGATGG - Intronic
1056765262 9:89441237-89441259 TGTGTGGAAGCGGAGGCCAAGGG - Intronic
1057719096 9:97518019-97518041 CGTGTGGAAGCTGAGGCGATGGG - Intronic
1057872503 9:98728943-98728965 TGCGCGGAAGGAGAGGCCAATGG + Intergenic
1058523943 9:105838596-105838618 GGTGAGGATACGGAGGCCAATGG + Intergenic
1059055325 9:110973048-110973070 AGTGTGGAATCGCAGGACAAAGG + Intronic
1059425964 9:114221138-114221160 TGTGTGACAGAGGAGGGCAATGG - Intronic
1060888050 9:127169352-127169374 TTAGTGGAAGATGAGGCCAAAGG - Intronic
1060996054 9:127875432-127875454 AGTGAAGAAGTGGAGGCCAAAGG - Intronic
1061010852 9:127953792-127953814 TGTGCGCAAGGTGAGGCCAAGGG - Exonic
1061236182 9:129343943-129343965 TGTCTGGATGCGGAAGCCAAGGG + Intergenic
1061370746 9:130196066-130196088 TGGGTGGAGGCTGAGGCAAAGGG + Intronic
1185579084 X:1196663-1196685 TGTATGGAAACTGAGGCCCAGGG + Intronic
1186188535 X:7045241-7045263 TGTGTGGCTGGGGAGGCCACAGG - Intergenic
1187288033 X:17924990-17925012 TATGAGGAAGCTGAGGCCTAGGG + Intergenic
1187856832 X:23644903-23644925 TGTGCGGGAGCTGAGGCCCAAGG + Intergenic
1188653872 X:32666353-32666375 TGTCTGGGAGTGGAGGGCAAGGG - Intronic
1190107826 X:47572131-47572153 GGTGGGGAAGCGGAGACCACTGG + Exonic
1191952699 X:66610818-66610840 TGTGGGGAATCGCAGGCCCATGG - Intronic
1192168065 X:68838414-68838436 AGTGTGGAAGGGGTGGCCCATGG - Intronic
1192347214 X:70320674-70320696 GGTGTGGGAGTGGAGGCCGAGGG + Intronic
1192542946 X:71990508-71990530 TGTGTAGAAGGGGTGGCCCACGG - Intergenic
1195344342 X:103934486-103934508 TGTCTGGGAGCGGGGGGCAAGGG - Intronic
1199619950 X:149690185-149690207 TGTGCGGAAGCAGAGGCAACAGG - Intronic
1199997766 X:153037118-153037140 TGTGTGGAAGAAGTGGCCCAGGG + Intergenic
1200076567 X:153554204-153554226 TGGGTGGTAGCGGAGGACAGGGG + Intronic