ID: 1056765263

View in Genome Browser
Species Human (GRCh38)
Location 9:89441238-89441260
Sequence GTGTGTGGAAGCGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765263_1056765270 -5 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765263_1056765274 20 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765274 9:89441281-89441303 GCACTGTTCCTCCCAGCAGCGGG No data
1056765263_1056765271 -2 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765263_1056765267 -10 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765263_1056765269 -6 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765263_1056765273 19 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765273 9:89441280-89441302 GGCACTGTTCCTCCCAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765263 Original CRISPR GTGTGTGGAAGCGGAGGCCA AGG (reversed) Intronic
900172111 1:1274168-1274190 GGGCGTGGGAGCGGAGGACAAGG - Intergenic
900361338 1:2290478-2290500 GTGTCTGGAAGCAAAGGCCCTGG - Intronic
900387651 1:2417852-2417874 AGGTGAGGAAGCTGAGGCCAGGG - Intergenic
900518727 1:3095569-3095591 GGATGTGGAAGCTGAGTCCAGGG - Intronic
900565292 1:3329077-3329099 GTGAGTGGAAGAGGGGTCCAGGG - Intronic
901168110 1:7234291-7234313 CTGGGTGGAAGCGGAGGCGAAGG - Intronic
903149657 1:21397846-21397868 GGGTGGAGAAGCGGAGGCCCAGG + Intergenic
905183427 1:36179853-36179875 GACTGTGGATGCAGAGGCCAAGG - Exonic
905527592 1:38650751-38650773 GGGCCTGGAAGAGGAGGCCATGG + Intergenic
907163027 1:52385437-52385459 GGGTGGAGAAACGGAGGCCAAGG - Intronic
907481428 1:54748029-54748051 GTGTGTGCAAGTGGGGGCCTGGG - Intergenic
907518364 1:55007510-55007532 GTGTGGGGAAACTGAGGCTAGGG - Intronic
908024878 1:59939845-59939867 GTCTGTGGTGGCGGTGGCCATGG - Intergenic
908299857 1:62753304-62753326 GAGAGTGGACGCCGAGGCCAAGG - Intergenic
910772181 1:90841740-90841762 GTGGGGGGAAGGGGACGCCATGG - Intergenic
911148126 1:94571202-94571224 GGGTGGGGGAGCGGAGGCCGAGG + Intergenic
912537760 1:110388371-110388393 GTGTTTGGAAAGGGAGGACAAGG - Intronic
912813867 1:112813611-112813633 GTGTAGGGAAGCGGGGGGCAGGG - Intergenic
913511965 1:119570394-119570416 CTGTGTGGAAGCGAAGCTCATGG - Intergenic
915141605 1:153771693-153771715 GTGGGTGGGTGGGGAGGCCAGGG + Intronic
915444196 1:155965575-155965597 GAGTGTGGCAGTGGAGGCCAAGG - Intronic
915583464 1:156830234-156830256 GTGTGTGGAAGCCTGGGCCCAGG + Intronic
918627935 1:186680195-186680217 GTGCGTGGAACCGGAGTCCCCGG + Intronic
920078225 1:203352504-203352526 GTATGGAGAAGGGGAGGCCAGGG + Intergenic
920193712 1:204212313-204212335 GTGTGTGAAGGTGGAGACCAAGG - Intronic
920215430 1:204359079-204359101 GTATGTGGTAGAGGAGGGCAGGG - Intronic
920597308 1:207285280-207285302 GTTTGGGGAAGAGCAGGCCATGG - Intergenic
922991147 1:229912731-229912753 GTGTGTGGAATGGGAGAGCATGG + Intergenic
924573142 1:245256430-245256452 GGATGAGGAAGCTGAGGCCAAGG + Intronic
1062787549 10:278100-278122 GCGTGTGGACGCCGAGGGCATGG + Intronic
1063126570 10:3141705-3141727 GTCTGTGGAAGCGGCGACCTGGG - Intronic
1063229904 10:4054822-4054844 GTCTGTGGGAGGAGAGGCCAAGG + Intergenic
1063302026 10:4858554-4858576 GTGTGTGGAAGATCAGGCCAGGG + Intergenic
1063451187 10:6151376-6151398 GAGTGTTGAAGCCCAGGCCAGGG - Intronic
1063567640 10:7184752-7184774 GGGTGTGGGAGCGGAGGACGAGG + Intronic
1063864098 10:10345259-10345281 GTGTGTGAAAGTGGTTGCCATGG - Intergenic
1064369512 10:14739001-14739023 GTATGTGGAGGAGGAAGCCATGG - Intronic
1064594957 10:16934626-16934648 GTGTTTGGAAGTGGAGACAAAGG - Intronic
1066982557 10:42431867-42431889 CTGTGGGGAATCGGAGGCAAGGG - Intergenic
1067015978 10:42756505-42756527 GAGTGTGGAAGCTGAGCCCAGGG + Intergenic
1067101702 10:43338986-43339008 ATGAGGGGAAGAGGAGGCCATGG + Intergenic
1067478877 10:46582879-46582901 GAGTGTGACTGCGGAGGCCAGGG + Intronic
1067615861 10:47758922-47758944 GAGTGTGACTGCGGAGGCCAGGG - Intergenic
1067744736 10:48927227-48927249 GTGTGTGGAAGCAGGGGGGAGGG - Intronic
1070657586 10:78282062-78282084 CTGTCTGGAAGCTGATGCCAAGG + Intergenic
1070680749 10:78447499-78447521 GTGTGTGTCAGGGGAGGCAAGGG + Intergenic
1071074259 10:81732488-81732510 GTGTGGGGAAGGGAAGGTCATGG + Intergenic
1071821657 10:89286373-89286395 GGGTGGGGGAGCGGAGGCTAAGG - Intronic
1072611248 10:97018960-97018982 GTGAGTGGAGGCAGAGGCCGGGG - Intronic
1073760420 10:106623041-106623063 GTGTGTAGAAGCAAAGGCCCTGG - Intronic
1076549995 10:131272166-131272188 GTGTGTGGAGGCGCAAGACACGG - Intronic
1077124436 11:926140-926162 GGGTCTGGGAGCGGAGGCCCGGG + Intronic
1077439322 11:2560633-2560655 GGGTGTGGAAGGGGAGGCTGAGG - Intronic
1077551212 11:3201115-3201137 GGGAGAGGAAGAGGAGGCCAGGG - Intergenic
1077889161 11:6406143-6406165 GTGTGTGAAAGCAAAGGCCGGGG - Intronic
1078095606 11:8294742-8294764 GGGAGTGGAAGCAGAAGCCAAGG - Intergenic
1079354551 11:19719327-19719349 TTGTGAGAAAGCAGAGGCCAAGG + Intronic
1079571915 11:21953399-21953421 GCCTGTGGAAGTGGTGGCCATGG + Intergenic
1081279140 11:41187121-41187143 GTGTTGGGAAGGGGAGGGCATGG + Intronic
1081793866 11:45806337-45806359 GTGAGTGGCAGCTGGGGCCACGG + Intronic
1082068920 11:47922908-47922930 ATGTGTGGGAGGGAAGGCCACGG - Intergenic
1083188843 11:61035220-61035242 GTGTGTGGAAGGGGAGGAAGAGG - Intergenic
1083639576 11:64138227-64138249 CTGGGTGGAGGCCGAGGCCAGGG + Intronic
1083854926 11:65388425-65388447 GTGTGTGGAAGGGAAGGGCACGG - Intronic
1084155729 11:67311560-67311582 GTGTGAGGATACGGAAGCCATGG - Intronic
1084193537 11:67509958-67509980 GGGGGTGGAAGCGGAGACCGAGG + Intergenic
1086904459 11:92403090-92403112 GCGTATGTAAGCTGAGGCCATGG - Intronic
1089497431 11:118914725-118914747 GGGTGTGGGAGAGGAGGCCTGGG - Intronic
1089699206 11:120234348-120234370 GTGGGTGCCAGCGTAGGCCAGGG - Intergenic
1091821504 12:3478995-3479017 GTGTGAGAAAGAGGAGGCCAAGG + Intronic
1092373406 12:7935617-7935639 GTGTTTGGAGGCACAGGCCAGGG - Intronic
1098541716 12:71664341-71664363 GTATGTGGGGGCGGAGGCGAAGG - Exonic
1099640544 12:85279439-85279461 GAGTGTGGACGCGGTGGCGATGG - Intergenic
1100259956 12:92923592-92923614 GGGTGTGGTAGGGGAGGGCAAGG - Intronic
1101291257 12:103372069-103372091 AAGTGAGGAAGTGGAGGCCAGGG - Intronic
1101642689 12:106599917-106599939 GAGAATGGAAGAGGAGGCCACGG - Intronic
1101744256 12:107526443-107526465 CTGTGGGGAAGCAGAGGCCCTGG + Intronic
1102526321 12:113514910-113514932 GTGGGTGGATGCAGAGGGCACGG - Intergenic
1102969566 12:117155551-117155573 GGCTGTGGGAGCGGAGGCCCTGG + Intronic
1103009140 12:117444568-117444590 GTGGCTGGAATCAGAGGCCAGGG + Intronic
1103341511 12:120223631-120223653 GTGGGAGGCAGCGGAGGCCCGGG - Intronic
1104647003 12:130504841-130504863 GACTGGGGAAGGGGAGGCCAGGG - Intronic
1104814222 12:131636800-131636822 GAGGGTGGCAGCTGAGGCCATGG - Intergenic
1104920423 12:132287731-132287753 GTGTGTGGAATGGGTGCCCAAGG + Intronic
1107650281 13:42538051-42538073 CTGTGGGAAAGGGGAGGCCAGGG - Intergenic
1108734631 13:53269761-53269783 GTGAGTGGCAGGGGAGGCCTGGG - Intergenic
1108837570 13:54571003-54571025 GTGTGTGAAAGAGGAGTCAAAGG + Intergenic
1111190738 13:84803422-84803444 GTGTGGGAATGCGGAGGCCGGGG + Intergenic
1111412198 13:87891769-87891791 TTGTGTGGAACATGAGGCCATGG - Intergenic
1112306620 13:98280263-98280285 GGGTGTGGAGGGGGAGGGCATGG - Intronic
1112563396 13:100532990-100533012 GTGTGGGGAGGCTGAGGGCACGG - Intronic
1113197326 13:107823577-107823599 TGGAGTGGGAGCGGAGGCCACGG - Intronic
1113662200 13:112115175-112115197 GTGAGTGGAAGGGCTGGCCATGG + Intergenic
1113961131 13:114126795-114126817 GTTTGTGAAAGTGGAGGCCAAGG - Intronic
1114069489 14:19096279-19096301 GAGTGTGGAAGCTGAGCCCAGGG - Intergenic
1114092773 14:19303724-19303746 GAGTGTGGAAGCTGAGCCCAGGG + Intergenic
1115645398 14:35365709-35365731 GGGTGGGGAAGCACAGGCCAGGG - Intergenic
1116551918 14:46251242-46251264 GTGTGAGGAAGTGAAGGACAGGG + Intergenic
1116854590 14:49940406-49940428 GTGTGGGTAAGAGGAGGCCTGGG + Intergenic
1117141088 14:52791634-52791656 GCGAGCGGAGGCGGAGGCCAAGG + Intronic
1117174078 14:53130136-53130158 GGGTGGGGGAGCAGAGGCCAAGG - Intronic
1120759673 14:88274197-88274219 GTGTGTGGAAGAAGAGGGGAGGG - Intronic
1120763515 14:88307079-88307101 GTGAGTGGATGAGAAGGCCAAGG + Intronic
1121657160 14:95605476-95605498 GTGTGTGGAGGGGCAGGCCAAGG + Intergenic
1123013189 14:105359113-105359135 GTGTGTGGATGCGAAGGCCTGGG - Intronic
1124609872 15:31201074-31201096 GTATGTGGAAGCCGAGGCCCAGG - Intergenic
1124622274 15:31280443-31280465 GTGTGTGGCAGATGAGGCCCTGG - Intergenic
1128683265 15:69666486-69666508 GGATGTGGAAACGGAGGCCCAGG + Intergenic
1129057744 15:72833818-72833840 GTGTGAGGAAGTTCAGGCCATGG + Intergenic
1129205589 15:74035468-74035490 GAGGGTGCAAGCGGAGGGCATGG - Intronic
1129766602 15:78173538-78173560 GTGTGGGAAGGCAGAGGCCATGG - Intronic
1130146903 15:81281382-81281404 GTGTGTGGGAGAGGAGGGCCTGG - Intronic
1132055557 15:98648540-98648562 GTGTGTGGCAGCGGCGGCGGCGG + Intergenic
1132321755 15:100930520-100930542 GTGTGGGGTGGGGGAGGCCAGGG - Intronic
1132563391 16:609226-609248 GTGAGGGGAAGGGGAGGTCAGGG + Intronic
1132666459 16:1083286-1083308 GTGTGGGGAAGACGGGGCCAAGG + Intergenic
1132942490 16:2514855-2514877 GTGTGTGGAAGTGGAGGGAGCGG + Intronic
1133009129 16:2900632-2900654 GAGTGAGGAAGAGGAGGCCGGGG + Intergenic
1133438469 16:5800566-5800588 ATGTGTGGAATTGGAGGACACGG + Intergenic
1135094252 16:19551327-19551349 GTCTGTGTAAACGGAGTCCAGGG - Exonic
1135356500 16:21773372-21773394 GAGGGTGGAAGGGGAGGTCAGGG + Intergenic
1135454996 16:22589515-22589537 GAGGGTGGAAGGGGAGGTCAGGG + Intergenic
1136135237 16:28252631-28252653 GTGTGTGGAAGAGGAGGGATAGG - Intergenic
1136371661 16:29840525-29840547 GTGTGTGGAAGAGGTGGGCAGGG + Intronic
1136406895 16:30053364-30053386 GTTTGGGGAAACTGAGGCCATGG - Intronic
1137539703 16:49353818-49353840 CTCTGTGGAAACGGAAGCCACGG - Intergenic
1138264568 16:55651242-55651264 GGGTCAGGAAGGGGAGGCCAAGG + Intergenic
1138475796 16:57270155-57270177 GTGTTTGGACTCGGGGGCCATGG - Intronic
1139147027 16:64337622-64337644 GTGTTTGGATGTGGATGCCATGG + Intergenic
1139334232 16:66219884-66219906 CTGTGTGGCAGGGGAGGACAGGG + Intergenic
1139348465 16:66320343-66320365 GTGTGTGGAAACTGAGGCACGGG + Intergenic
1139492370 16:67293225-67293247 ATGTTTGGAAGCGCAGGGCATGG - Intronic
1139776807 16:69321474-69321496 GTGTGTGAAAGCAGAGGACAGGG + Intronic
1139779634 16:69339913-69339935 GTGTGTGGGTGTGGTGGCCAAGG + Intronic
1140122359 16:72094316-72094338 GTGGGTTAAAGCGGAGGCCTGGG - Intronic
1140719243 16:77756120-77756142 GGGTGTGGAAGAGGAAGCCATGG - Intergenic
1141557933 16:84848276-84848298 CTGTCTGGAAGCGGAGCGCACGG - Intronic
1141612118 16:85187715-85187737 GTGTGTGGGTGAGGAGCCCAAGG - Intergenic
1141831751 16:86512994-86513016 GTGCATGGAAGAGGACGCCATGG - Exonic
1141877894 16:86838617-86838639 CTGAGTGGAAGTGCAGGCCATGG + Intergenic
1143059753 17:4189901-4189923 GTGTGTGGACACAGAGGCTAGGG + Intronic
1143090582 17:4447132-4447154 GGGTGTGGAAGTGGTGGCCGTGG + Intronic
1143233563 17:5378680-5378702 GTGTGTGGAAGGGGAGAGCAGGG - Intronic
1144148312 17:12419707-12419729 CTGTGAGGAAACAGAGGCCAGGG - Intergenic
1144942306 17:18950196-18950218 GAGGGTGGCAGCGGAGGACATGG - Intergenic
1146002685 17:29140559-29140581 GTGTGTGGAAGGGAAGGAGAAGG + Intronic
1146668362 17:34719938-34719960 GAGTGCGGAAACTGAGGCCAGGG - Intergenic
1147985838 17:44307665-44307687 GTGAGAGGAATAGGAGGCCAAGG + Intergenic
1148021475 17:44556758-44556780 GTGTGTGGAGGGGGAGGGCGAGG + Intergenic
1148083440 17:44980015-44980037 GGGTGTGAAAGCGGAGCCCAGGG - Intergenic
1148494211 17:48042900-48042922 GTGTGGGGAAGCGGTTGTCATGG - Intergenic
1148847954 17:50540284-50540306 GTGTGTGGAGGGCGGGGCCAGGG - Exonic
1149516938 17:57287925-57287947 GAGTGTGGGAGAGCAGGCCAGGG + Intronic
1150265881 17:63832211-63832233 GTATGTGCATGTGGAGGCCAGGG - Exonic
1150815529 17:68389378-68389400 GTGTGTGGATGAGGGTGCCAGGG + Intronic
1151365233 17:73612475-73612497 GAGGGTAGAAGAGGAGGCCAAGG + Intronic
1151970724 17:77456199-77456221 GTGGGTGGGAGCCGAGGCCAGGG + Intronic
1152089414 17:78238462-78238484 GTGTGAGGAAGAGGAGGCGGGGG + Intronic
1153301198 18:3593582-3593604 GTGTGTGTAAGGGGAGGAGAGGG + Intronic
1154412555 18:14149243-14149265 ATGGGTGGAGGTGGAGGCCAGGG - Intergenic
1155222337 18:23697018-23697040 ATATGAGGAAGAGGAGGCCAAGG + Intronic
1155963983 18:32019074-32019096 ATGTGGGGAAGCTGAGGGCATGG + Intronic
1157339073 18:46763058-46763080 GTGGTGGGAAGGGGAGGCCAAGG - Intergenic
1157713347 18:49865221-49865243 GAGTGAGGAAGCTGAGCCCAGGG + Intronic
1159913123 18:74165130-74165152 GTGTGTGGAAGCTGAGGTGACGG - Intergenic
1160535731 18:79590333-79590355 GTGTCTGGATGTGGAGGCCAGGG - Intergenic
1161219278 19:3110596-3110618 GGGTGGGGAAGCTGAGGCCCTGG + Intronic
1161428374 19:4216885-4216907 GACTATGGAAGCTGAGGCCACGG + Exonic
1163021328 19:14482471-14482493 TTGTGGGGAACTGGAGGCCAGGG - Intronic
1163323770 19:16589966-16589988 GTGTGTTGTAGAGGTGGCCAGGG - Intronic
1163415961 19:17186663-17186685 GGGGGTGGATGTGGAGGCCAGGG - Intronic
1164753271 19:30671400-30671422 GGGTGTGGAAGCAGTGACCAGGG + Intronic
1165302505 19:34979650-34979672 GTGTGTGGAAGAGCAGACCCTGG + Intergenic
1165944405 19:39433060-39433082 GTGAGTGGAAGCAGAAGGCAGGG - Intergenic
1166783079 19:45352355-45352377 GTGGGCAGAAGCGCAGGCCAGGG + Intronic
1166851973 19:45765551-45765573 GGGGTTGGAAGCTGAGGCCAAGG - Exonic
1167264145 19:48475007-48475029 GTGTGCGGAAGCTGAGTCCAGGG - Intronic
1168272229 19:55256365-55256387 GTGAGTGGAGGTGGAGGCTAGGG - Intronic
925410551 2:3637465-3637487 GTGTGTGATGGAGGAGGCCACGG + Intronic
926265555 2:11316230-11316252 GTGGGTGGAAGAGGAGGTGATGG + Intronic
926953006 2:18264366-18264388 GTGTGTGAATGGGGTGGCCAGGG + Intronic
927376489 2:22421016-22421038 GTGAGTGGAAGCTGATGCCCAGG - Intergenic
927484405 2:23478889-23478911 GGGTGTGGAAGCCCAGGACATGG - Intronic
928111663 2:28515369-28515391 GTGTTTGTAACTGGAGGCCAGGG - Intronic
929919392 2:46161651-46161673 GGGTGTGGCAGAGGAAGCCAGGG + Intronic
930199550 2:48540077-48540099 ATGTATGGAAGCTGAGGCCAAGG - Intronic
930222140 2:48755748-48755770 GTGTGTGGAAGGGCAGCCAAGGG - Intronic
933210314 2:79559459-79559481 CTGTGTGGAAATGGAGGGCAGGG + Intronic
934163977 2:89277695-89277717 GTGGGTGGGAGCTGAGGCCAGGG + Intergenic
934203297 2:89904829-89904851 GTGGGTGGGAGCTGAGGCCAGGG - Intergenic
935130342 2:100256764-100256786 GTGGGAGGAAGCGCAGGCCCAGG - Intergenic
937345214 2:121121161-121121183 GACTGTGGAAGGGGAGGGCAGGG + Intergenic
940578261 2:155542695-155542717 GTGTGGGGAAGAGGATCCCAGGG - Intergenic
940984374 2:160038047-160038069 GTCTGTGGAAATGGAGGTCAAGG + Intronic
941181622 2:162266145-162266167 GTTTGTGGAAGGGAAGGCCTAGG + Intergenic
941721506 2:168817587-168817609 GTGTGGGGTAGGGGAGGACAGGG - Intronic
942162303 2:173203849-173203871 GTGTTGGGAAGCTGATGCCAAGG + Exonic
942776145 2:179584868-179584890 GTGTTTGAAAGAGGAGCCCATGG + Intronic
943185313 2:184598915-184598937 GTGCGTGGAAGCGGCGGCTGCGG + Exonic
944675908 2:202034114-202034136 GGGTGTGGAGGAGGAGGCGAAGG + Intergenic
945124036 2:206488734-206488756 GTGTGTGGAAGTGAATGCCAAGG + Intronic
946290112 2:218738194-218738216 TTCTGTGGATGAGGAGGCCATGG - Exonic
947312300 2:228817948-228817970 GCCTGTGGTAGTGGAGGCCATGG - Intergenic
947398982 2:229714125-229714147 GTGAGTGGAAGCGGCGGGCGCGG - Intronic
948994661 2:241572329-241572351 GCCAGTGGGAGCGGAGGCCAGGG - Exonic
1171494834 20:25548518-25548540 GGGTGTGGGAGCTGTGGCCATGG - Intronic
1171494850 20:25548568-25548590 GGGTGTGGGAGCTGTGGCCACGG - Intronic
1171495110 20:25549369-25549391 GGGTGTGGGAGCTGTGGCCATGG - Intronic
1171495128 20:25549419-25549441 GGGTGTGGGAGCTGTGGCCATGG - Intronic
1171981662 20:31633102-31633124 GTGGGGGGATGCTGAGGCCATGG + Intergenic
1172006549 20:31822423-31822445 GTGTGTGGGAGCAGTGACCAAGG + Intronic
1172519101 20:35555929-35555951 GTGGGAGGAAGGGGAGGCTATGG - Intronic
1173812039 20:45962003-45962025 GGGTGGGGAAGTGGAGGCCCGGG - Intronic
1174255731 20:49253579-49253601 GACTGTTGAAGCAGAGGCCAGGG + Intronic
1174408120 20:50316153-50316175 TTATGTGGGAGGGGAGGCCAAGG - Intergenic
1175796317 20:61773435-61773457 GTGTGTGGAAGCAGTGGGCAGGG + Intronic
1175864874 20:62170127-62170149 GTGTGTGAAACAAGAGGCCACGG - Intronic
1175935983 20:62514239-62514261 AGGTGGGGAAGCTGAGGCCAGGG + Intergenic
1176021158 20:62963109-62963131 GTGTCTGGTAGGGGAGGCCAAGG + Intronic
1176374665 21:6081070-6081092 GTGTGTGGAAGCAGATGGGATGG + Intergenic
1176860453 21:14009013-14009035 ATGGGTGGAGGTGGAGGCCAGGG + Intergenic
1179410346 21:41157890-41157912 GTGTGTGAATGTGAAGGCCAGGG - Intergenic
1179488802 21:41727417-41727439 GTTTGTTAAAACGGAGGCCACGG - Intergenic
1179499282 21:41796894-41796916 TTGGGTGGAAGGGGAGGCCCCGG + Intergenic
1179748810 21:43457175-43457197 GTGTGTGGAAGCAGATGGGATGG - Intergenic
1180030396 21:45202650-45202672 GTGTGGGGACAGGGAGGCCAGGG - Intronic
1180043371 21:45291839-45291861 GTGTTTGGAGGCGGTGGCCTGGG - Intergenic
1180069962 21:45431335-45431357 GTGTGTGGACCCGGCGGCCCAGG + Intronic
1180487958 22:15818842-15818864 GAGTGTGGAAGCTGAGCCCAGGG - Intergenic
1181002996 22:19996753-19996775 GCGAGTGAAAGCAGAGGCCAGGG + Intronic
1181514884 22:23404751-23404773 CTGTGGGGAAGTGGAGGCCCAGG - Intergenic
1181921266 22:26322311-26322333 GTCAGTGGAAGTGGAGGCTACGG - Intronic
1182086893 22:27567140-27567162 GTGTGTGGAGGAGGAACCCAAGG + Intergenic
1183409348 22:37645809-37645831 GTGTGTGGCAGTGGAGCCCCTGG - Intronic
1184031854 22:41899882-41899904 GGGAGTGGAAGGGGAGGCTAGGG - Intronic
1184243713 22:43225097-43225119 GTGGGAGGAAACTGAGGCCAAGG - Intronic
1184658340 22:45953218-45953240 GTGAGGGGAAGCCGAGGACACGG - Intronic
1184658346 22:45953246-45953268 GTGAGGGGAAGCCGAGGACACGG - Intronic
1184658352 22:45953274-45953296 GTGAGAGGAAGCCGAGGACACGG - Intronic
1185365713 22:50435792-50435814 ATGGGTGGAGGTGGAGGCCAGGG + Intronic
950003180 3:9673360-9673382 GTGTGTGCAACCTGTGGCCAGGG + Intronic
950139283 3:10604139-10604161 GTGTGAGGGAGGTGAGGCCAAGG - Intronic
950188539 3:10960366-10960388 GTGTGATGATGCAGAGGCCAGGG + Intergenic
950304514 3:11907787-11907809 CTGGGTGGAAGGGGAGGCCATGG - Intergenic
950429043 3:12940494-12940516 GTGGGTGGGAGTGAAGGCCAGGG + Intronic
950531003 3:13552363-13552385 GTGAGTGAAAGGGGAGGCCAGGG + Intronic
951258503 3:20479689-20479711 GTGTGTGCAAGGGGGGGGCAGGG - Intergenic
952497432 3:33928329-33928351 GTGGGAGGAAGCTGAGTCCAGGG - Intergenic
953348054 3:42192293-42192315 ATTTGTGGAAGCTGAAGCCAGGG + Intronic
953571564 3:44075819-44075841 GGGTGTGGATGGGGAGGACATGG + Intergenic
954458050 3:50610702-50610724 GAGGGTGGAAGGTGAGGCCAAGG - Intronic
954681693 3:52349527-52349549 GTCTGTGGATGCCCAGGCCAAGG + Intronic
955782695 3:62502804-62502826 GTGGGTGGAGGAGGAGGCCCAGG + Intronic
955851014 3:63219855-63219877 GGATGTGGAAGGGGAGGCAAGGG + Intergenic
955878836 3:63522683-63522705 ATGTGTGGAATGGGAGGCAAGGG + Intronic
959084100 3:101833345-101833367 GGGTGTGGAAGGGGAGGAGAAGG - Intronic
962672231 3:137720594-137720616 GTGTGTGCAGGGGGAGGTCAGGG - Intergenic
963226822 3:142871036-142871058 GGCTTTGGCAGCGGAGGCCAGGG - Intronic
963784012 3:149514817-149514839 CTTTGTGGAGGCAGAGGCCATGG + Intergenic
964553351 3:157909478-157909500 GTGAGAGGAAGAGGAGGTCAAGG + Intergenic
966592187 3:181695591-181695613 GAGTGGGGAAGCGGAGGCGCGGG - Intergenic
968557105 4:1251076-1251098 CTGTGTGTAGACGGAGGCCATGG - Intergenic
969713450 4:8857555-8857577 GGGTGCGGAGGCCGAGGCCAGGG - Intronic
969840810 4:9880335-9880357 GATTGAGGAAGCGGAGGGCAGGG + Intronic
970535071 4:17022382-17022404 GTGTGAGGTAGATGAGGCCATGG - Intergenic
971383656 4:26123413-26123435 GTGAGTGGATGCGAAGGCCTAGG + Intergenic
972338353 4:38128632-38128654 CTGGGTGGAAGAGGTGGCCAAGG + Intronic
974988704 4:69059813-69059835 GTGTGTGGAAAACTAGGCCACGG + Intronic
975496403 4:75040184-75040206 GTTTGGGGAAGGGGAAGCCATGG + Intronic
979175148 4:117653182-117653204 GAGTGTGGAAGCAGAGGCTGGGG - Intergenic
980968261 4:139544832-139544854 GTGTGTGGAGGGGGAGGCGGAGG + Intronic
985703501 5:1387417-1387439 GTGAGGGGAGGAGGAGGCCAGGG + Intergenic
985886979 5:2687432-2687454 ATGTGGGGAAACTGAGGCCAGGG - Intergenic
986060225 5:4182158-4182180 ATGTGTGGAAACAGAGACCAGGG - Intergenic
987535055 5:19175165-19175187 GTGTGGGGAAGAGGATGACAAGG + Intergenic
989533052 5:42530196-42530218 GTGTGTGCAAGAGGAGGTAAGGG + Intronic
992832762 5:80610968-80610990 GTGTATGGGAGGGGAGGCCGGGG - Intergenic
995047853 5:107670902-107670924 GTGTGTGGTGGCGGCGGCGAGGG + Intergenic
995314220 5:110749496-110749518 GTGTGTGGGAGCGGTGGGAAGGG + Intronic
997209912 5:132071173-132071195 CTGTGTGGTAGCTGAGGCCACGG - Intergenic
997704614 5:135936272-135936294 GTGTGTGGAAGAGGTGGCTTGGG - Intronic
998042949 5:138964967-138964989 GCGTGGGGAAGCTGAGCCCAGGG + Intronic
999611480 5:153374832-153374854 GGGTATCGAAGAGGAGGCCAAGG - Intergenic
999830854 5:155318040-155318062 GTGAGTGGATAAGGAGGCCAAGG - Intergenic
1000157485 5:158565942-158565964 CTGTGAGGAAGAGAAGGCCAAGG - Intergenic
1000829484 5:166085311-166085333 ATGTGGGGATGGGGAGGCCAAGG - Intergenic
1001416225 5:171546270-171546292 GTGTGTGAAAGCGAAGGGCAGGG + Intergenic
1002107084 5:176885070-176885092 GAGTGGGGAAGGGGAGGCAAAGG + Intronic
1003517773 6:6832154-6832176 GTGTGGGGCAGTGGAGGTCATGG - Intergenic
1004050148 6:12069385-12069407 GTGAGTGGATGGGGAGGCCTAGG + Intronic
1005881695 6:30067250-30067272 GGGTGGAGAAGCGGAGGCCCAGG + Exonic
1006080089 6:31560106-31560128 GTGAGAGGAACCGGACGCCAGGG - Intergenic
1006298271 6:33179630-33179652 GTGTGCGGCAGGGGAGGCCTGGG - Intronic
1006670368 6:35726521-35726543 GTGTGTGGAGGAGGAGGAGATGG - Intronic
1006904455 6:37523630-37523652 TTGAGGGGAAGAGGAGGCCAGGG + Intergenic
1007247576 6:40473423-40473445 GGGAGTGGAAACGGAGGCCTGGG - Intronic
1010083240 6:71887272-71887294 GTGTGGGGAAGGGGCTGCCAGGG + Intronic
1013443056 6:110190920-110190942 GTGTGTGGTATGGGAAGCCAGGG - Intronic
1014935058 6:127377088-127377110 GTGAGGGGAAGAGGAGGACATGG - Intergenic
1015916754 6:138225316-138225338 AAGTGTGAAAGCAGAGGCCAGGG - Intronic
1015988548 6:138911568-138911590 GTGTGAGGGAGAGGAGGACAGGG + Intronic
1016388085 6:143548525-143548547 GTGTGTGGAATTGGATTCCAAGG - Intronic
1017837226 6:158189450-158189472 CTCAGTGGAAGAGGAGGCCAGGG - Intronic
1017942923 6:159068902-159068924 GTGTGTGGAAGCAAAGCCCAGGG + Intergenic
1018445805 6:163857219-163857241 GTGTGGGGAAGAGGAGCTCAAGG - Intergenic
1023716298 7:43047341-43047363 GTGTGTGGTGGTGGTGGCCATGG + Intergenic
1024255361 7:47536716-47536738 GTGTGTGCACGCGCAGGACAAGG - Intronic
1024823988 7:53367585-53367607 GTGTGGGGAAGAGCAGGGCAGGG + Intergenic
1026447570 7:70498968-70498990 CTTTGTGGAAGAGGAGGGCAAGG + Intronic
1029422143 7:100477369-100477391 GAGGGTGGAAGCGGAGGCTGGGG - Exonic
1029514518 7:101017313-101017335 CGGGGTGGAAGCGGGGGCCACGG - Intronic
1029580982 7:101436423-101436445 TAGTGAGGAAGTGGAGGCCAGGG + Intronic
1032489636 7:132314522-132314544 GAGTCTGGAAAGGGAGGCCACGG + Intronic
1033643496 7:143284586-143284608 GTGACTGGAAGCGGAGACCTCGG - Intronic
1034424811 7:151008947-151008969 CTGTGTGGGAGAGGATGCCAAGG + Exonic
1035300505 7:157894332-157894354 GTGTGTGGAAGCTGAGAGCTGGG + Intronic
1036224004 8:6943148-6943170 GTGACAGGAAGCTGAGGCCATGG - Intergenic
1036430482 8:8685277-8685299 GTGTGTGAATGGCGAGGCCAGGG - Intergenic
1036618692 8:10408121-10408143 CTGTCTGGAAACAGAGGCCAGGG + Intronic
1037674270 8:21040960-21040982 GGGCGGGGAAGTGGAGGCCAAGG - Intergenic
1037948321 8:23003228-23003250 GAGGGTGGATGCCGAGGCCAGGG + Intronic
1039232031 8:35459017-35459039 ATGTGTGGGAGTGGAGGTCAAGG - Intronic
1039922629 8:41904015-41904037 GTGGGTGGTAGTGGAAGCCAAGG - Intergenic
1040799500 8:51325412-51325434 TTGTGTGTCAACGGAGGCCAAGG - Intronic
1040843678 8:51811802-51811824 GTGGGTGGAAGTGGAGGCAGGGG - Intergenic
1041042537 8:53862038-53862060 GTGTGAGGAACAGGAGGCAAAGG + Intronic
1041651930 8:60310535-60310557 GGGTGGGAAAGCGGAGGCCGAGG + Intergenic
1042951615 8:74205951-74205973 ATGTGTGGAAGGAGAGGCTATGG - Intergenic
1044511901 8:93091321-93091343 GTGTGTGGAAGTAGAGGTGAAGG - Intergenic
1046792003 8:118332599-118332621 GTGTGTGCATGCAGAGGGCATGG + Intronic
1047290534 8:123525711-123525733 AGGTGAGGAAGCAGAGGCCAGGG - Intronic
1048251702 8:132871490-132871512 GTGTGTGGACGCAGAGGGGATGG + Exonic
1048971770 8:139649093-139649115 AGGTGTGGGAGGGGAGGCCACGG - Intronic
1049311085 8:141934232-141934254 GTGTATGGAGGCAGCGGCCATGG - Intergenic
1049761992 8:144335969-144335991 GAGTGTGGGGGCGGAGGGCAGGG - Intronic
1050528386 9:6565418-6565440 GTCTTTGCAAGCGGAGCCCAGGG - Exonic
1051191483 9:14517602-14517624 GTGTGTGGTAGCGGTGGTCGTGG + Intergenic
1051655362 9:19376112-19376134 GTGTGTGGTAGTGGAAGACAAGG - Exonic
1053158948 9:35800330-35800352 GTGAGTGGGAGAGGAGCCCAGGG + Intronic
1055862965 9:80775678-80775700 TTGTGTGGTAGAGGAGGCCTAGG + Intergenic
1056765263 9:89441238-89441260 GTGTGTGGAAGCGGAGGCCAAGG - Intronic
1056992531 9:91424364-91424386 GTGCGGGGAAGGGGAGGCCGAGG - Intergenic
1057719097 9:97518020-97518042 ACGTGTGGAAGCTGAGGCGATGG - Intronic
1057812663 9:98269844-98269866 GGGTGTGGGAGCAGAGGCCGAGG + Intergenic
1057911113 9:99021273-99021295 GTGTGGGGAAGGGAGGGCCAGGG + Intronic
1058161291 9:101573062-101573084 GTGTGGGGAAGCTGAGGTCTAGG - Exonic
1058232406 9:102444614-102444636 GTGTGTGGAATCGGAGGGCAAGG - Intergenic
1058612321 9:106789882-106789904 GGGTGGAGGAGCGGAGGCCAAGG - Intergenic
1058665117 9:107306497-107306519 AGGTGTGGAAGTGGGGGCCAAGG - Exonic
1058967186 9:110048900-110048922 GTGTGAGGAAGGGGTGGCCGAGG + Intronic
1059390625 9:113997652-113997674 GGGTGAGGAAGCAGAGGCTAGGG - Intronic
1060022661 9:120145835-120145857 GTGTGTATAAGTGGACGCCAGGG + Intergenic
1060029619 9:120203144-120203166 GTGTGAGGAAGCTGAGACCCAGG - Intergenic
1060151220 9:121289552-121289574 ATGTGCGGAAGAGGAGGCCGTGG + Intronic
1060556037 9:124507586-124507608 GAGGGTGGGGGCGGAGGCCAAGG + Intergenic
1060941446 9:127545280-127545302 GGCTGTGGGAGTGGAGGCCAGGG - Intronic
1061236181 9:129343942-129343964 TTGTCTGGATGCGGAAGCCAAGG + Intergenic
1061513866 9:131077164-131077186 CTGGGAGGAAGCAGAGGCCACGG - Intronic
1062683680 9:137799004-137799026 GTGCGTGGGAGGGGACGCCATGG - Intronic
1062683720 9:137799164-137799186 GTGTGTGGAAGGCGATGCCGTGG - Intronic
1189090099 X:38073107-38073129 TTGAGTGGAAGAAGAGGCCATGG - Intronic
1189262298 X:39687574-39687596 TTGTGAGAAAGAGGAGGCCAAGG + Intergenic
1190597620 X:52063875-52063897 GTGTGGGGAGCCGAAGGCCAGGG - Intronic
1190611204 X:52190198-52190220 GTGTGGGGAGCCGAAGGCCAGGG + Intronic
1192347213 X:70320673-70320695 GGGTGTGGGAGTGGAGGCCGAGG + Intronic
1192764736 X:74129185-74129207 GGGTGGGGAAGCGGAGGCTATGG + Intergenic
1193331458 X:80239340-80239362 GTGTGTGGTAGGGGAGGGGAGGG + Intergenic
1199122107 X:144067418-144067440 TTATGTTGGAGCGGAGGCCAAGG + Intergenic
1200076566 X:153554203-153554225 ATGGGTGGTAGCGGAGGACAGGG + Intronic
1201906988 Y:19095753-19095775 GTGTGGGGATGGGGAGGGCAAGG - Intergenic