ID: 1056765263

View in Genome Browser
Species Human (GRCh38)
Location 9:89441238-89441260
Sequence GTGTGTGGAAGCGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765263_1056765274 20 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765274 9:89441281-89441303 GCACTGTTCCTCCCAGCAGCGGG No data
1056765263_1056765267 -10 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765263_1056765270 -5 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765263_1056765271 -2 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765263_1056765273 19 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765273 9:89441280-89441302 GGCACTGTTCCTCCCAGCAGCGG No data
1056765263_1056765269 -6 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765263 Original CRISPR GTGTGTGGAAGCGGAGGCCA AGG (reversed) Intronic