ID: 1056765264

View in Genome Browser
Species Human (GRCh38)
Location 9:89441244-89441266
Sequence CTGCGCGTGTGTGGAAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765264_1056765271 -8 Left 1056765264 9:89441244-89441266 CCTCCGCTTCCACACACGCGCAG No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765264_1056765273 13 Left 1056765264 9:89441244-89441266 CCTCCGCTTCCACACACGCGCAG No data
Right 1056765273 9:89441280-89441302 GGCACTGTTCCTCCCAGCAGCGG No data
1056765264_1056765274 14 Left 1056765264 9:89441244-89441266 CCTCCGCTTCCACACACGCGCAG No data
Right 1056765274 9:89441281-89441303 GCACTGTTCCTCCCAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765264 Original CRISPR CTGCGCGTGTGTGGAAGCGG AGG (reversed) Intronic