ID: 1056765265

View in Genome Browser
Species Human (GRCh38)
Location 9:89441245-89441267
Sequence CTCCGCTTCCACACACGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765255_1056765265 20 Left 1056765255 9:89441202-89441224 CCTTAAACCAAACTCCCAGACCT 0: 1
1: 1
2: 1
3: 23
4: 194
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765258_1056765265 5 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765256_1056765265 13 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765257_1056765265 6 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765260_1056765265 0 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765265 Original CRISPR CTCCGCTTCCACACACGCGC AGG Intronic
No off target data available for this crispr