ID: 1056765270

View in Genome Browser
Species Human (GRCh38)
Location 9:89441256-89441278
Sequence CACACGCGCAGGACTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765258_1056765270 16 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765256_1056765270 24 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765260_1056765270 11 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765257_1056765270 17 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765261_1056765270 0 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA 0: 1
1: 0
2: 1
3: 30
4: 305
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765262_1056765270 -4 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765263_1056765270 -5 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765270 Original CRISPR CACACGCGCAGGACTCGGCC GGG Intronic
No off target data available for this crispr