ID: 1056765271

View in Genome Browser
Species Human (GRCh38)
Location 9:89441259-89441281
Sequence ACGCGCAGGACTCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765258_1056765271 19 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765257_1056765271 20 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765256_1056765271 27 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765261_1056765271 3 Left 1056765261 9:89441233-89441255 CCAACCCTTGGCCTCCGCTTCCA No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765264_1056765271 -8 Left 1056765264 9:89441244-89441266 CCTCCGCTTCCACACACGCGCAG No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765263_1056765271 -2 Left 1056765263 9:89441238-89441260 CCTTGGCCTCCGCTTCCACACAC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765262_1056765271 -1 Left 1056765262 9:89441237-89441259 CCCTTGGCCTCCGCTTCCACACA No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765260_1056765271 14 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765271 Original CRISPR ACGCGCAGGACTCGGCCGGG CGG Intronic