ID: 1056769125

View in Genome Browser
Species Human (GRCh38)
Location 9:89464357-89464379
Sequence GGTGGGGCTGAGGACCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056769113_1056769125 15 Left 1056769113 9:89464319-89464341 CCTTCCGACCTGGGTTTCGGATG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG No data
1056769114_1056769125 11 Left 1056769114 9:89464323-89464345 CCGACCTGGGTTTCGGATGATTA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG No data
1056769111_1056769125 19 Left 1056769111 9:89464315-89464337 CCTGCCTTCCGACCTGGGTTTCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG No data
1056769115_1056769125 7 Left 1056769115 9:89464327-89464349 CCTGGGTTTCGGATGATTATAAA 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056769125 Original CRISPR GGTGGGGCTGAGGACCTCAG GGG Intronic
No off target data available for this crispr