ID: 1056769399

View in Genome Browser
Species Human (GRCh38)
Location 9:89465974-89465996
Sequence GTGACTCCTGCATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056769394_1056769399 30 Left 1056769394 9:89465921-89465943 CCGATGGGAAGGTGATGCTGCAG 0: 1
1: 0
2: 2
3: 20
4: 395
Right 1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056769399 Original CRISPR GTGACTCCTGCATTTCTTGG AGG Intronic
No off target data available for this crispr