ID: 1056770965

View in Genome Browser
Species Human (GRCh38)
Location 9:89478157-89478179
Sequence GCCTTCTTGTGTGCTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056770956_1056770965 28 Left 1056770956 9:89478106-89478128 CCTGTCTCCGCCCACCAGGGCCA 0: 1
1: 0
2: 4
3: 69
4: 1079
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770963_1056770965 -4 Left 1056770963 9:89478138-89478160 CCCGCGCAGTATTTCAATTGCCT 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770959_1056770965 17 Left 1056770959 9:89478117-89478139 CCACCAGGGCCACCAGCTCAGCC 0: 1
1: 1
2: 10
3: 67
4: 594
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770958_1056770965 18 Left 1056770958 9:89478116-89478138 CCCACCAGGGCCACCAGCTCAGC 0: 1
1: 0
2: 0
3: 34
4: 307
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770955_1056770965 29 Left 1056770955 9:89478105-89478127 CCCTGTCTCCGCCCACCAGGGCC 0: 1
1: 1
2: 4
3: 38
4: 361
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770961_1056770965 8 Left 1056770961 9:89478126-89478148 CCACCAGCTCAGCCCGCGCAGTA 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770962_1056770965 5 Left 1056770962 9:89478129-89478151 CCAGCTCAGCCCGCGCAGTATTT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770960_1056770965 14 Left 1056770960 9:89478120-89478142 CCAGGGCCACCAGCTCAGCCCGC 0: 1
1: 0
2: 6
3: 53
4: 418
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770957_1056770965 21 Left 1056770957 9:89478113-89478135 CCGCCCACCAGGGCCACCAGCTC 0: 1
1: 0
2: 2
3: 68
4: 541
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data
1056770964_1056770965 -5 Left 1056770964 9:89478139-89478161 CCGCGCAGTATTTCAATTGCCTT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056770965 Original CRISPR GCCTTCTTGTGTGCTGTAAC AGG Intronic
No off target data available for this crispr