ID: 1056771376

View in Genome Browser
Species Human (GRCh38)
Location 9:89480558-89480580
Sequence GCCCCGTGGGAAGGCAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056771363_1056771376 29 Left 1056771363 9:89480506-89480528 CCATGGAGTGGGTGGGAGGCTCA 0: 200
1: 214
2: 197
3: 130
4: 354
Right 1056771376 9:89480558-89480580 GCCCCGTGGGAAGGCAGTCAAGG No data
1056771362_1056771376 30 Left 1056771362 9:89480505-89480527 CCCATGGAGTGGGTGGGAGGCTC 0: 198
1: 206
2: 199
3: 124
4: 255
Right 1056771376 9:89480558-89480580 GCCCCGTGGGAAGGCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056771376 Original CRISPR GCCCCGTGGGAAGGCAGTCA AGG Intronic
No off target data available for this crispr