ID: 1056777595

View in Genome Browser
Species Human (GRCh38)
Location 9:89525092-89525114
Sequence GCTGCAGCCGAGACTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056777595_1056777606 28 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777595_1056777602 11 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data
1056777595_1056777597 -4 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777597 9:89525111-89525133 CAGCCCCCTGAGAGAAAGCCTGG No data
1056777595_1056777604 19 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777604 9:89525134-89525156 ATGAGCTCCGCCTGGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056777595 Original CRISPR GCTGCAGCCGAGACTGAGGC CGG (reversed) Intergenic
No off target data available for this crispr