ID: 1056777602

View in Genome Browser
Species Human (GRCh38)
Location 9:89525126-89525148
Sequence AAGCCTGGATGAGCTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056777595_1056777602 11 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data
1056777594_1056777602 12 Left 1056777594 9:89525091-89525113 CCCGGCCTCAGTCTCGGCTGCAG No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data
1056777593_1056777602 16 Left 1056777593 9:89525087-89525109 CCTGCCCGGCCTCAGTCTCGGCT No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data
1056777596_1056777602 7 Left 1056777596 9:89525096-89525118 CCTCAGTCTCGGCTGCAGCCCCC No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data
1056777592_1056777602 17 Left 1056777592 9:89525086-89525108 CCCTGCCCGGCCTCAGTCTCGGC No data
Right 1056777602 9:89525126-89525148 AAGCCTGGATGAGCTCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056777602 Original CRISPR AAGCCTGGATGAGCTCCGCC TGG Intergenic
No off target data available for this crispr