ID: 1056777606

View in Genome Browser
Species Human (GRCh38)
Location 9:89525143-89525165
Sequence GCCTGGTCTGATGGAGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056777599_1056777606 5 Left 1056777599 9:89525115-89525137 CCCCTGAGAGAAAGCCTGGATGA No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777600_1056777606 4 Left 1056777600 9:89525116-89525138 CCCTGAGAGAAAGCCTGGATGAG No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777594_1056777606 29 Left 1056777594 9:89525091-89525113 CCCGGCCTCAGTCTCGGCTGCAG No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777596_1056777606 24 Left 1056777596 9:89525096-89525118 CCTCAGTCTCGGCTGCAGCCCCC No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777595_1056777606 28 Left 1056777595 9:89525092-89525114 CCGGCCTCAGTCTCGGCTGCAGC No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777603_1056777606 -9 Left 1056777603 9:89525129-89525151 CCTGGATGAGCTCCGCCTGGTCT No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777601_1056777606 3 Left 1056777601 9:89525117-89525139 CCTGAGAGAAAGCCTGGATGAGC No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data
1056777598_1056777606 6 Left 1056777598 9:89525114-89525136 CCCCCTGAGAGAAAGCCTGGATG No data
Right 1056777606 9:89525143-89525165 GCCTGGTCTGATGGAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056777606 Original CRISPR GCCTGGTCTGATGGAGACTC TGG Intergenic
No off target data available for this crispr