ID: 1056778006

View in Genome Browser
Species Human (GRCh38)
Location 9:89527912-89527934
Sequence GGGTGATTCACCTCCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056778006_1056778010 -3 Left 1056778006 9:89527912-89527934 CCCTGCTGGGAGGTGAATCACCC No data
Right 1056778010 9:89527932-89527954 CCCAAACAGGAGCGCCCACATGG No data
1056778006_1056778012 1 Left 1056778006 9:89527912-89527934 CCCTGCTGGGAGGTGAATCACCC No data
Right 1056778012 9:89527936-89527958 AACAGGAGCGCCCACATGGATGG No data
1056778006_1056778015 17 Left 1056778006 9:89527912-89527934 CCCTGCTGGGAGGTGAATCACCC No data
Right 1056778015 9:89527952-89527974 TGGATGGAGATACGCACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056778006 Original CRISPR GGGTGATTCACCTCCCAGCA GGG (reversed) Intergenic
No off target data available for this crispr