ID: 1056778437

View in Genome Browser
Species Human (GRCh38)
Location 9:89531584-89531606
Sequence GAAGCTTCCTGGACCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056778437_1056778444 7 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778444 9:89531614-89531636 AGGGCCTGAAAGACAAAAAGGGG No data
1056778437_1056778448 25 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778448 9:89531632-89531654 AGGGGTGCACACAGAGCCAGGGG No data
1056778437_1056778442 5 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778442 9:89531612-89531634 TCAGGGCCTGAAAGACAAAAAGG No data
1056778437_1056778443 6 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778443 9:89531613-89531635 CAGGGCCTGAAAGACAAAAAGGG No data
1056778437_1056778447 24 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778447 9:89531631-89531653 AAGGGGTGCACACAGAGCCAGGG No data
1056778437_1056778446 23 Left 1056778437 9:89531584-89531606 CCCTCATGGGTCCAGGAAGCTTC No data
Right 1056778446 9:89531630-89531652 AAAGGGGTGCACACAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056778437 Original CRISPR GAAGCTTCCTGGACCCATGA GGG (reversed) Intergenic
No off target data available for this crispr