ID: 1056780214

View in Genome Browser
Species Human (GRCh38)
Location 9:89543607-89543629
Sequence AAAATCACCCAGCCAAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056780210_1056780214 8 Left 1056780210 9:89543576-89543598 CCAGGGCATCAGAAAGTGATCAG No data
Right 1056780214 9:89543607-89543629 AAAATCACCCAGCCAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056780214 Original CRISPR AAAATCACCCAGCCAAGGTC TGG Intergenic
No off target data available for this crispr