ID: 1056782833

View in Genome Browser
Species Human (GRCh38)
Location 9:89564206-89564228
Sequence TTTTTGTTGAATGGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056782827_1056782833 7 Left 1056782827 9:89564176-89564198 CCGCACAGTGGTTCATGTGGTTT No data
Right 1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG No data
1056782826_1056782833 8 Left 1056782826 9:89564175-89564197 CCCGCACAGTGGTTCATGTGGTT No data
Right 1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG No data
1056782825_1056782833 9 Left 1056782825 9:89564174-89564196 CCCCGCACAGTGGTTCATGTGGT No data
Right 1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG No data
1056782823_1056782833 10 Left 1056782823 9:89564173-89564195 CCCCCGCACAGTGGTTCATGTGG No data
Right 1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056782833 Original CRISPR TTTTTGTTGAATGGGGAATA AGG Intergenic
No off target data available for this crispr