ID: 1056784338

View in Genome Browser
Species Human (GRCh38)
Location 9:89579331-89579353
Sequence AAGCAAACACACACAAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056784332_1056784338 9 Left 1056784332 9:89579299-89579321 CCTCAGGAAACTTATAATCATGG 0: 571
1: 6815
2: 8322
3: 6642
4: 4578
Right 1056784338 9:89579331-89579353 AAGCAAACACACACAAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056784338 Original CRISPR AAGCAAACACACACAAACCA TGG Intergenic
No off target data available for this crispr