ID: 1056784431

View in Genome Browser
Species Human (GRCh38)
Location 9:89580092-89580114
Sequence ATAGTCACGTGGATAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056784431_1056784437 17 Left 1056784431 9:89580092-89580114 CCAAAATCTATCCACGTGACTAT No data
Right 1056784437 9:89580132-89580154 ACACGGGCAGAGACTGCTGTTGG No data
1056784431_1056784434 1 Left 1056784431 9:89580092-89580114 CCAAAATCTATCCACGTGACTAT No data
Right 1056784434 9:89580116-89580138 TGCCTCCTGTATGTGAACACGGG No data
1056784431_1056784438 18 Left 1056784431 9:89580092-89580114 CCAAAATCTATCCACGTGACTAT No data
Right 1056784438 9:89580133-89580155 CACGGGCAGAGACTGCTGTTGGG No data
1056784431_1056784433 0 Left 1056784431 9:89580092-89580114 CCAAAATCTATCCACGTGACTAT No data
Right 1056784433 9:89580115-89580137 CTGCCTCCTGTATGTGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056784431 Original CRISPR ATAGTCACGTGGATAGATTT TGG (reversed) Intergenic
No off target data available for this crispr