ID: 1056786081

View in Genome Browser
Species Human (GRCh38)
Location 9:89593440-89593462
Sequence CTCACTGTCTTGCACACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056786073_1056786081 20 Left 1056786073 9:89593397-89593419 CCTGAGGTCAGAACCCAGTCCAC No data
Right 1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG No data
1056786075_1056786081 6 Left 1056786075 9:89593411-89593433 CCAGTCCACTGCTCGATCCTCAG No data
Right 1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG No data
1056786074_1056786081 7 Left 1056786074 9:89593410-89593432 CCCAGTCCACTGCTCGATCCTCA No data
Right 1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG No data
1056786076_1056786081 1 Left 1056786076 9:89593416-89593438 CCACTGCTCGATCCTCAGCCCCA No data
Right 1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056786081 Original CRISPR CTCACTGTCTTGCACACAGT AGG Intergenic
No off target data available for this crispr