ID: 1056787571

View in Genome Browser
Species Human (GRCh38)
Location 9:89604055-89604077
Sequence CCGTGCGAGGAACGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056787562_1056787571 6 Left 1056787562 9:89604026-89604048 CCTTCCCAACTCGCGCGGCTGTT No data
Right 1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG No data
1056787565_1056787571 1 Left 1056787565 9:89604031-89604053 CCAACTCGCGCGGCTGTTCGGCA No data
Right 1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG No data
1056787564_1056787571 2 Left 1056787564 9:89604030-89604052 CCCAACTCGCGCGGCTGTTCGGC No data
Right 1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG No data
1056787561_1056787571 10 Left 1056787561 9:89604022-89604044 CCGTCCTTCCCAACTCGCGCGGC No data
Right 1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056787571 Original CRISPR CCGTGCGAGGAACGGATGGA AGG Intergenic
No off target data available for this crispr