ID: 1056787970

View in Genome Browser
Species Human (GRCh38)
Location 9:89606072-89606094
Sequence GTCCCCGCCGGGCTGTCACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056787970_1056787979 23 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787979 9:89606118-89606140 GCCCCGGGGCGCCTAGAGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 135
1056787970_1056787978 9 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787978 9:89606104-89606126 ATCGACGTGGTGACGCCCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1056787970_1056787977 8 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787977 9:89606103-89606125 GATCGACGTGGTGACGCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1056787970_1056787983 27 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787983 9:89606122-89606144 CGGGGCGCCTAGAGCGCGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 107
1056787970_1056787974 -4 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787974 9:89606091-89606113 GGACCTTGGTCTGATCGACGTGG 0: 1
1: 0
2: 0
3: 0
4: 20
1056787970_1056787976 7 Left 1056787970 9:89606072-89606094 CCGAGTGACAGCCCGGCGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1056787976 9:89606102-89606124 TGATCGACGTGGTGACGCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056787970 Original CRISPR GTCCCCGCCGGGCTGTCACT CGG (reversed) Exonic
900310048 1:2029245-2029267 GTGCCCGCCAGGGTGTCTCTAGG + Exonic
901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG + Intronic
902911027 1:19597255-19597277 GGCCCCGGCGGGAGGTCACTCGG + Intronic
916451296 1:164922927-164922949 CTCCCAGCTGGTCTGTCACTTGG - Intergenic
919792184 1:201299159-201299181 CTCCACTCCGGGCTGTCTCTGGG - Intronic
922783798 1:228273186-228273208 AGCCCTGCCTGGCTGTCACTGGG + Intronic
1062878110 10:958138-958160 GTGCCCACTGGGTTGTCACTTGG + Intergenic
1066049206 10:31619306-31619328 GTCCCGGCCCGGCTTCCACTGGG + Intergenic
1067781307 10:49209342-49209364 GTGCCTGCTGTGCTGTCACTGGG - Intergenic
1070305347 10:75235879-75235901 GTGCCCGCCGCGCTGGCCCTGGG - Exonic
1073066452 10:100762284-100762306 GTCCACACCGGGGTTTCACTGGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1075544694 10:123346288-123346310 TTCCCTTCCTGGCTGTCACTTGG + Intergenic
1076537335 10:131188052-131188074 AGCCCTGCCCGGCTGTCACTTGG - Intronic
1079032276 11:16994582-16994604 GTCCCAGCAGGGCTGTGACCGGG - Intronic
1079450706 11:20597872-20597894 CCTCCCGCCGGGCTGTCGCTAGG - Intergenic
1084313000 11:68327349-68327371 GTCCCCTCCTGGCCTTCACTGGG - Intronic
1088735255 11:112723440-112723462 GACCCCGCCTGGCTGTGACTTGG + Intergenic
1089567275 11:119378408-119378430 CTCCCCTCCAGCCTGTCACTAGG + Intronic
1091445197 12:541166-541188 GGCCCTGCCGGGCCCTCACTGGG - Intronic
1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG + Intronic
1113743064 13:112724470-112724492 GTCCCCGTGGAGCTGTCACGTGG + Intronic
1114577123 14:23725580-23725602 GCCCCCTCTGGGCTGTCACAGGG + Intergenic
1118324575 14:64772500-64772522 GTCCCCACCTGGCTGTCAGCAGG - Intronic
1119682025 14:76599629-76599651 CTCCCCGCCGGCCAGTCACCTGG + Intergenic
1119775321 14:77244517-77244539 TTCCCCGCCAGCCTGGCACTTGG + Intronic
1122939693 14:104975757-104975779 GACCCGCCCGCGCTGTCACTCGG + Intronic
1128582222 15:68818334-68818356 CTCCCCGCCGCGCTGCCCCTGGG - Intronic
1131731190 15:95283123-95283145 TTTTCTGCCGGGCTGTCACTGGG + Intergenic
1131827674 15:96333569-96333591 TTCCCCGCCGGGCTGGGGCTGGG + Intronic
1136598052 16:31265508-31265530 TGCCCCGCCGGGCTGGGACTGGG + Intronic
1141094880 16:81156018-81156040 GTCTGGGCCGGGCTGTCACTGGG + Intergenic
1142263383 16:89052673-89052695 CTCCCCTCCGAGCTGGCACTGGG - Intergenic
1142695106 17:1629067-1629089 TTCCCGGCCGCGCTGTGACTCGG - Intergenic
1151876406 17:76869961-76869983 GGCCCCGCCGGGCGTCCACTGGG - Intronic
1162128990 19:8513911-8513933 GTCCGCCGCTGGCTGTCACTCGG - Intronic
1163323217 19:16586650-16586672 CTCCCCACCGGGCTGGCCCTGGG + Intronic
1163823285 19:19508475-19508497 GGCCCAGCGGGGCTGCCACTGGG - Exonic
925034081 2:672757-672779 GTCCCTGCAGGGGTGTCCCTGGG - Intronic
927477694 2:23426371-23426393 GTGGCCGCCGGGAAGTCACTTGG - Intronic
929436786 2:41934784-41934806 CTCCCAGCCGGACTGTCCCTCGG + Intergenic
931739414 2:65228215-65228237 GTCCCTGCCGGGCGGTCAGTAGG - Intronic
942467751 2:176226249-176226271 GTTCCTCCCTGGCTGTCACTTGG - Intergenic
1168814039 20:724522-724544 GTGCCAGCCTTGCTGTCACTGGG - Intergenic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175876047 20:62230722-62230744 GTCCCACCTGGGCTGTCCCTGGG + Intergenic
1176040042 20:63060545-63060567 GTCCCCTCCTGGCTGGCCCTGGG + Intergenic
1176172356 20:63701716-63701738 GTACCCCCTGGGCAGTCACTGGG + Intronic
1176207062 20:63894979-63895001 CTCGGCCCCGGGCTGTCACTCGG + Intergenic
1178687406 21:34722629-34722651 GTCCCCCTCGGCCGGTCACTGGG + Intergenic
1179430219 21:41316597-41316619 TTCCCCGCCGGGCTGACCCCGGG - Intronic
1181051937 22:20242018-20242040 TTGCCCGGCGGGCTGTCACCGGG + Exonic
1181802555 22:25357195-25357217 GGCCCTGCCCGGCTGTCCCTGGG - Intronic
1181808556 22:25390176-25390198 GTCCCCTCCTGGCCTTCACTGGG + Intronic
1181817427 22:25448742-25448764 GTCCCCGTCAGGCTCGCACTAGG - Intergenic
1181918354 22:26299005-26299027 TTCCCCGCCGGCCTGACTCTGGG + Exonic
1183437797 22:37805311-37805333 AGCCCCGCCGGTCTGTCGCTTGG - Exonic
1185343109 22:50300258-50300280 GTCCCCGCGGGGCGCTCACCTGG + Intronic
954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG + Intergenic
966372158 3:179261419-179261441 CTCCCCGGCGGGCTGGCTCTTGG - Intronic
968089695 3:195892502-195892524 GACCCCCCCGAGCAGTCACTGGG + Intronic
969098399 4:4751370-4751392 TTGCCAGCAGGGCTGTCACTTGG - Intergenic
971169122 4:24215140-24215162 CTCCCAGCCTGGCTGTCACCTGG + Intergenic
983020634 4:162671493-162671515 GTCCTCACATGGCTGTCACTTGG - Intergenic
985788927 5:1915134-1915156 GTCCCCGCATTGCTCTCACTGGG + Intergenic
985901850 5:2802498-2802520 CTCCCCACCGGGCTGACAGTAGG + Intergenic
997297281 5:132776381-132776403 GTCCCTGCAGGGGTCTCACTGGG - Intronic
999495046 5:152088626-152088648 GACCATGCTGGGCTGTCACTTGG + Intergenic
1006187108 6:32187822-32187844 GTCCTGGCAGGGCTGTCACATGG + Intronic
1006751372 6:36380020-36380042 GTCCACACAGGGCTGTCACAAGG + Intronic
1007638247 6:43314375-43314397 GTCCCTGGAGGGCTGTCACATGG + Intronic
1018101505 6:160445056-160445078 GGCCCCGCCTGCCTGCCACTGGG - Intronic
1018782257 6:167078729-167078751 TGCCCCACAGGGCTGTCACTTGG + Intergenic
1029123998 7:98285083-98285105 GTACTGGCTGGGCTGTCACTGGG + Intronic
1032122586 7:129167977-129167999 CTTCCCACTGGGCTGTCACTGGG - Exonic
1036749354 8:11434274-11434296 GTCCCCGCCCTGCAGTCTCTGGG - Intronic
1036964079 8:13276699-13276721 GTCCGCGCCGGGCTGCTCCTGGG + Intronic
1038054447 8:23845074-23845096 GGTCTCGCCGGGCTCTCACTGGG - Intronic
1039060010 8:33565806-33565828 CTCCGCGCCCGGCTGTCCCTGGG - Intronic
1040570096 8:48600682-48600704 GTCCTAGCTGGGCTTTCACTTGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1053415888 9:37946573-37946595 GGTCCTGCCGGGCTGGCACTGGG - Intronic
1056787970 9:89606072-89606094 GTCCCCGCCGGGCTGTCACTCGG - Exonic
1056873169 9:90304027-90304049 GGCTCCGCTGGTCTGTCACTGGG + Intergenic
1062265112 9:135683439-135683461 GTCCCCGCCAGCCTGACCCTTGG + Intergenic
1062721581 9:138047055-138047077 GTCCCCGCCAGGCTGTGGCGGGG + Intronic
1187740301 X:22348556-22348578 GTCTCAGCCGGGCTGTCTCATGG - Intergenic