ID: 1056790880

View in Genome Browser
Species Human (GRCh38)
Location 9:89624573-89624595
Sequence CTGTGGATTTGGGGTTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056790872_1056790880 1 Left 1056790872 9:89624549-89624571 CCTCATGGGCACGGCTCCTGAGG No data
Right 1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056790880 Original CRISPR CTGTGGATTTGGGGTTCAGA GGG Intergenic
No off target data available for this crispr