ID: 1056792406

View in Genome Browser
Species Human (GRCh38)
Location 9:89634270-89634292
Sequence GACACGTCCTTGTGCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056792402_1056792406 -3 Left 1056792402 9:89634250-89634272 CCACACACACCCCATGGTATGAC No data
Right 1056792406 9:89634270-89634292 GACACGTCCTTGTGCTCTCCTGG No data
1056792399_1056792406 7 Left 1056792399 9:89634240-89634262 CCCTAGCATACCACACACACCCC No data
Right 1056792406 9:89634270-89634292 GACACGTCCTTGTGCTCTCCTGG No data
1056792400_1056792406 6 Left 1056792400 9:89634241-89634263 CCTAGCATACCACACACACCCCA No data
Right 1056792406 9:89634270-89634292 GACACGTCCTTGTGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056792406 Original CRISPR GACACGTCCTTGTGCTCTCC TGG Intergenic
No off target data available for this crispr