ID: 1056793140

View in Genome Browser
Species Human (GRCh38)
Location 9:89639185-89639207
Sequence GGCCCCAGGAGCCACACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056793140_1056793148 3 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793148 9:89639211-89639233 GCTTCACTCCTTCAAGGGCCAGG No data
1056793140_1056793145 -2 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793145 9:89639206-89639228 CCCCAGCTTCACTCCTTCAAGGG No data
1056793140_1056793155 24 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793155 9:89639232-89639254 GGATGTTGAAGAAGGGGGAAAGG No data
1056793140_1056793143 -3 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793143 9:89639205-89639227 GCCCCAGCTTCACTCCTTCAAGG No data
1056793140_1056793153 19 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793153 9:89639227-89639249 GGCCAGGATGTTGAAGAAGGGGG No data
1056793140_1056793150 16 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793150 9:89639224-89639246 AAGGGCCAGGATGTTGAAGAAGG No data
1056793140_1056793152 18 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793152 9:89639226-89639248 GGGCCAGGATGTTGAAGAAGGGG No data
1056793140_1056793156 25 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793156 9:89639233-89639255 GATGTTGAAGAAGGGGGAAAGGG No data
1056793140_1056793151 17 Left 1056793140 9:89639185-89639207 CCCGCAGTGTGGCTCCTGGGGCC No data
Right 1056793151 9:89639225-89639247 AGGGCCAGGATGTTGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056793140 Original CRISPR GGCCCCAGGAGCCACACTGC GGG (reversed) Intergenic
No off target data available for this crispr