ID: 1056799952

View in Genome Browser
Species Human (GRCh38)
Location 9:89684045-89684067
Sequence GGAAGCACAAAATATCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056799944_1056799952 5 Left 1056799944 9:89684017-89684039 CCTGCCACCTGTGGCCGCCATAA No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data
1056799948_1056799952 -9 Left 1056799948 9:89684031-89684053 CCGCCATAATGCCAGGAAGCACA No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data
1056799941_1056799952 15 Left 1056799941 9:89684007-89684029 CCCAACAAGTCCTGCCACCTGTG No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data
1056799946_1056799952 -2 Left 1056799946 9:89684024-89684046 CCTGTGGCCGCCATAATGCCAGG No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data
1056799942_1056799952 14 Left 1056799942 9:89684008-89684030 CCAACAAGTCCTGCCACCTGTGG No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data
1056799945_1056799952 1 Left 1056799945 9:89684021-89684043 CCACCTGTGGCCGCCATAATGCC No data
Right 1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056799952 Original CRISPR GGAAGCACAAAATATCCCAT GGG Intergenic
No off target data available for this crispr