ID: 1056804529

View in Genome Browser
Species Human (GRCh38)
Location 9:89718379-89718401
Sequence GGAGACCAGGATCACTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804529_1056804543 30 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804529_1056804533 -1 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804533 9:89718401-89718423 CTCCACTCCCAGAGGTGCCAAGG No data
1056804529_1056804531 -9 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804531 9:89718393-89718415 CTGGTCTCCTCCACTCCCAGAGG No data
1056804529_1056804541 28 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1056804529_1056804542 29 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804529_1056804538 22 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804529 Original CRISPR GGAGACCAGGATCACTCTGA TGG (reversed) Intergenic