ID: 1056804530

View in Genome Browser
Species Human (GRCh38)
Location 9:89718392-89718414
Sequence CTCTGGGAGTGGAGGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804530_1056804542 16 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804530_1056804543 17 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804530_1056804544 24 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804530_1056804545 30 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804530_1056804541 15 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804530_1056804538 9 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804530 Original CRISPR CTCTGGGAGTGGAGGAGACC AGG (reversed) Intergenic
No off target data available for this crispr