ID: 1056804532

View in Genome Browser
Species Human (GRCh38)
Location 9:89718400-89718422
Sequence CTTGGCACCTCTGGGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804532_1056804542 8 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804532_1056804545 22 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804532_1056804548 29 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804532_1056804538 1 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804532_1056804544 16 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804532_1056804543 9 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804532_1056804541 7 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804532 Original CRISPR CTTGGCACCTCTGGGAGTGG AGG (reversed) Intergenic