ID: 1056804534

View in Genome Browser
Species Human (GRCh38)
Location 9:89718403-89718425
Sequence AACCTTGGCACCTCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804534_1056804544 13 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804534_1056804542 5 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804534_1056804548 26 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804534_1056804541 4 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1056804534_1056804538 -2 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804534_1056804543 6 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804534_1056804545 19 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804534 Original CRISPR AACCTTGGCACCTCTGGGAG TGG (reversed) Intergenic