ID: 1056804535

View in Genome Browser
Species Human (GRCh38)
Location 9:89718408-89718430
Sequence GGTGCAACCTTGGCACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804535_1056804542 0 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804535_1056804544 8 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804535_1056804538 -7 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804535_1056804548 21 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804535_1056804543 1 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804535_1056804550 27 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804550 9:89718458-89718480 TTGGCTGAGGCCACTGGACTGGG No data
1056804535_1056804541 -1 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1056804535_1056804549 26 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804549 9:89718457-89718479 CTTGGCTGAGGCCACTGGACTGG No data
1056804535_1056804545 14 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804535 Original CRISPR GGTGCAACCTTGGCACCTCT GGG (reversed) Intergenic