ID: 1056804537

View in Genome Browser
Species Human (GRCh38)
Location 9:89718418-89718440
Sequence CTTCAGCGAGGGTGCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804537_1056804542 -10 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804542 9:89718431-89718453 CTCGCTGAAGACAAGGCCCTGGG No data
1056804537_1056804543 -9 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804543 9:89718432-89718454 TCGCTGAAGACAAGGCCCTGGGG No data
1056804537_1056804548 11 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804537_1056804550 17 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804550 9:89718458-89718480 TTGGCTGAGGCCACTGGACTGGG No data
1056804537_1056804551 25 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804537_1056804545 4 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804537_1056804549 16 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804549 9:89718457-89718479 CTTGGCTGAGGCCACTGGACTGG No data
1056804537_1056804544 -2 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804537 Original CRISPR CTTCAGCGAGGGTGCAACCT TGG (reversed) Intergenic
No off target data available for this crispr