ID: 1056804538

View in Genome Browser
Species Human (GRCh38)
Location 9:89718424-89718446
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804534_1056804538 -2 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804535_1056804538 -7 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804529_1056804538 22 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804530_1056804538 9 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804536_1056804538 -8 Left 1056804536 9:89718409-89718431 CCAGAGGTGCCAAGGTTGCACCC No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data
1056804532_1056804538 1 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804538 Original CRISPR TTGCACCCTCGCTGAAGACA AGG Intergenic