ID: 1056804539

View in Genome Browser
Species Human (GRCh38)
Location 9:89718429-89718451
Sequence CAGGGCCTTGTCTTCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804539_1056804545 -7 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804539_1056804549 5 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804549 9:89718457-89718479 CTTGGCTGAGGCCACTGGACTGG No data
1056804539_1056804551 14 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804539_1056804548 0 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804539_1056804550 6 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804550 9:89718458-89718480 TTGGCTGAGGCCACTGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804539 Original CRISPR CAGGGCCTTGTCTTCAGCGA GGG (reversed) Intergenic
No off target data available for this crispr