ID: 1056804541

View in Genome Browser
Species Human (GRCh38)
Location 9:89718430-89718452
Sequence CCTCGCTGAAGACAAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804534_1056804541 4 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804536_1056804541 -2 Left 1056804536 9:89718409-89718431 CCAGAGGTGCCAAGGTTGCACCC No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804530_1056804541 15 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804529_1056804541 28 Left 1056804529 9:89718379-89718401 CCATCAGAGTGATCCTGGTCTCC No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804532_1056804541 7 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
1056804535_1056804541 -1 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804541 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804541 Original CRISPR CCTCGCTGAAGACAAGGCCC TGG Intergenic
No off target data available for this crispr