ID: 1056804544

View in Genome Browser
Species Human (GRCh38)
Location 9:89718439-89718461
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804536_1056804544 7 Left 1056804536 9:89718409-89718431 CCAGAGGTGCCAAGGTTGCACCC No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804535_1056804544 8 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804530_1056804544 24 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804534_1056804544 13 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804532_1056804544 16 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data
1056804537_1056804544 -2 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804544 9:89718439-89718461 AGACAAGGCCCTGGGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804544 Original CRISPR AGACAAGGCCCTGGGGCACT TGG Intergenic