ID: 1056804545

View in Genome Browser
Species Human (GRCh38)
Location 9:89718445-89718467
Sequence GGCCCTGGGGCACTTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804536_1056804545 13 Left 1056804536 9:89718409-89718431 CCAGAGGTGCCAAGGTTGCACCC No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804537_1056804545 4 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804530_1056804545 30 Left 1056804530 9:89718392-89718414 CCTGGTCTCCTCCACTCCCAGAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804539_1056804545 -7 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804535_1056804545 14 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804534_1056804545 19 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804540_1056804545 -8 Left 1056804540 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data
1056804532_1056804545 22 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804545 9:89718445-89718467 GGCCCTGGGGCACTTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804545 Original CRISPR GGCCCTGGGGCACTTGGCTG AGG Intergenic
No off target data available for this crispr