ID: 1056804548

View in Genome Browser
Species Human (GRCh38)
Location 9:89718452-89718474
Sequence GGGCACTTGGCTGAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804540_1056804548 -1 Left 1056804540 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804537_1056804548 11 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804536_1056804548 20 Left 1056804536 9:89718409-89718431 CCAGAGGTGCCAAGGTTGCACCC No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804532_1056804548 29 Left 1056804532 9:89718400-89718422 CCTCCACTCCCAGAGGTGCCAAG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804539_1056804548 0 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804535_1056804548 21 Left 1056804535 9:89718408-89718430 CCCAGAGGTGCCAAGGTTGCACC No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data
1056804534_1056804548 26 Left 1056804534 9:89718403-89718425 CCACTCCCAGAGGTGCCAAGGTT No data
Right 1056804548 9:89718452-89718474 GGGCACTTGGCTGAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804548 Original CRISPR GGGCACTTGGCTGAGGCCAC TGG Intergenic
No off target data available for this crispr