ID: 1056804551

View in Genome Browser
Species Human (GRCh38)
Location 9:89718466-89718488
Sequence GGCCACTGGACTGGGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056804547_1056804551 -5 Left 1056804547 9:89718448-89718470 CCTGGGGCACTTGGCTGAGGCCA No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804540_1056804551 13 Left 1056804540 9:89718430-89718452 CCTCGCTGAAGACAAGGCCCTGG No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804546_1056804551 -4 Left 1056804546 9:89718447-89718469 CCCTGGGGCACTTGGCTGAGGCC No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804539_1056804551 14 Left 1056804539 9:89718429-89718451 CCCTCGCTGAAGACAAGGCCCTG No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data
1056804537_1056804551 25 Left 1056804537 9:89718418-89718440 CCAAGGTTGCACCCTCGCTGAAG No data
Right 1056804551 9:89718466-89718488 GGCCACTGGACTGGGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056804551 Original CRISPR GGCCACTGGACTGGGCTTTG TGG Intergenic
No off target data available for this crispr