ID: 1056805542

View in Genome Browser
Species Human (GRCh38)
Location 9:89726120-89726142
Sequence CTGGGGGTGTTTGGGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805542_1056805555 28 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805542_1056805554 24 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805542_1056805557 30 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805542_1056805556 29 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805542 Original CRISPR CTGGGGGTGTTTGGGTGATT GGG (reversed) Intergenic