ID: 1056805543

View in Genome Browser
Species Human (GRCh38)
Location 9:89726121-89726143
Sequence CCTGGGGGTGTTTGGGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805543_1056805555 27 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805543_1056805556 28 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data
1056805543_1056805554 23 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805543_1056805557 29 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805543 Original CRISPR CCTGGGGGTGTTTGGGTGAT TGG (reversed) Intergenic