ID: 1056805547

View in Genome Browser
Species Human (GRCh38)
Location 9:89726128-89726150
Sequence CATAACCCCTGGGGGTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805547_1056805556 21 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data
1056805547_1056805554 16 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805547_1056805557 22 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805547_1056805559 25 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805559 9:89726176-89726198 TTTCCACTGCCAGGCAGGGGTGG No data
1056805547_1056805555 20 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805547 Original CRISPR CATAACCCCTGGGGGTGTTT GGG (reversed) Intergenic
No off target data available for this crispr