ID: 1056805550

View in Genome Browser
Species Human (GRCh38)
Location 9:89726137-89726159
Sequence TTTGGATTGCATAACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805550_1056805557 13 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805550_1056805559 16 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805559 9:89726176-89726198 TTTCCACTGCCAGGCAGGGGTGG No data
1056805550_1056805555 11 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805550_1056805556 12 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data
1056805550_1056805554 7 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805550 Original CRISPR TTTGGATTGCATAACCCCTG GGG (reversed) Intergenic