ID: 1056805551

View in Genome Browser
Species Human (GRCh38)
Location 9:89726138-89726160
Sequence GTTTGGATTGCATAACCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805551_1056805557 12 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805551_1056805555 10 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805551_1056805556 11 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data
1056805551_1056805554 6 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805551_1056805559 15 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805559 9:89726176-89726198 TTTCCACTGCCAGGCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805551 Original CRISPR GTTTGGATTGCATAACCCCT GGG (reversed) Intergenic
No off target data available for this crispr