ID: 1056805553

View in Genome Browser
Species Human (GRCh38)
Location 9:89726155-89726177
Sequence AAGGCAGAGAATCTCTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805553_1056805559 -2 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805559 9:89726176-89726198 TTTCCACTGCCAGGCAGGGGTGG No data
1056805553_1056805555 -7 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805553_1056805557 -5 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805553_1056805556 -6 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805556 9:89726172-89726194 TGCCTTTCCACTGCCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805553 Original CRISPR AAGGCAGAGAATCTCTTGTT TGG (reversed) Intergenic