ID: 1056805554

View in Genome Browser
Species Human (GRCh38)
Location 9:89726167-89726189
Sequence TTCTCTGCCTTTCCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805542_1056805554 24 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805551_1056805554 6 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805543_1056805554 23 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805552_1056805554 5 Left 1056805552 9:89726139-89726161 CCAGGGGTTATGCAATCCAAACA No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805548_1056805554 15 Left 1056805548 9:89726129-89726151 CCAAACACCCCCAGGGGTTATGC No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805541_1056805554 25 Left 1056805541 9:89726119-89726141 CCCCAATCACCCAAACACCCCCA No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805549_1056805554 8 Left 1056805549 9:89726136-89726158 CCCCCAGGGGTTATGCAATCCAA No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805547_1056805554 16 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data
1056805550_1056805554 7 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805554 9:89726167-89726189 TTCTCTGCCTTTCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805554 Original CRISPR TTCTCTGCCTTTCCACTGCC AGG Intergenic