ID: 1056805555

View in Genome Browser
Species Human (GRCh38)
Location 9:89726171-89726193
Sequence CTGCCTTTCCACTGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805541_1056805555 29 Left 1056805541 9:89726119-89726141 CCCCAATCACCCAAACACCCCCA No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805547_1056805555 20 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805549_1056805555 12 Left 1056805549 9:89726136-89726158 CCCCCAGGGGTTATGCAATCCAA No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805542_1056805555 28 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805543_1056805555 27 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805553_1056805555 -7 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805552_1056805555 9 Left 1056805552 9:89726139-89726161 CCAGGGGTTATGCAATCCAAACA No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805548_1056805555 19 Left 1056805548 9:89726129-89726151 CCAAACACCCCCAGGGGTTATGC No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805551_1056805555 10 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data
1056805550_1056805555 11 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805555 Original CRISPR CTGCCTTTCCACTGCCAGGC AGG Intergenic
No off target data available for this crispr