ID: 1056805557

View in Genome Browser
Species Human (GRCh38)
Location 9:89726173-89726195
Sequence GCCTTTCCACTGCCAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056805547_1056805557 22 Left 1056805547 9:89726128-89726150 CCCAAACACCCCCAGGGGTTATG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805543_1056805557 29 Left 1056805543 9:89726121-89726143 CCAATCACCCAAACACCCCCAGG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805550_1056805557 13 Left 1056805550 9:89726137-89726159 CCCCAGGGGTTATGCAATCCAAA No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805548_1056805557 21 Left 1056805548 9:89726129-89726151 CCAAACACCCCCAGGGGTTATGC No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805542_1056805557 30 Left 1056805542 9:89726120-89726142 CCCAATCACCCAAACACCCCCAG No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805549_1056805557 14 Left 1056805549 9:89726136-89726158 CCCCCAGGGGTTATGCAATCCAA No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805551_1056805557 12 Left 1056805551 9:89726138-89726160 CCCAGGGGTTATGCAATCCAAAC No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805552_1056805557 11 Left 1056805552 9:89726139-89726161 CCAGGGGTTATGCAATCCAAACA No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data
1056805553_1056805557 -5 Left 1056805553 9:89726155-89726177 CCAAACAAGAGATTCTCTGCCTT No data
Right 1056805557 9:89726173-89726195 GCCTTTCCACTGCCAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056805557 Original CRISPR GCCTTTCCACTGCCAGGCAG GGG Intergenic