ID: 1056806920

View in Genome Browser
Species Human (GRCh38)
Location 9:89736177-89736199
Sequence CTGTCAGCAGGGGCTGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056806911_1056806920 16 Left 1056806911 9:89736138-89736160 CCTCTTGCTGCCAGACTGAGGTC No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data
1056806909_1056806920 19 Left 1056806909 9:89736135-89736157 CCTCCTCTTGCTGCCAGACTGAG No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data
1056806916_1056806920 -8 Left 1056806916 9:89736162-89736184 CCACACTCTTGCTGGCTGTCAGC No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data
1056806912_1056806920 6 Left 1056806912 9:89736148-89736170 CCAGACTGAGGTCCCCACACTCT No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data
1056806915_1056806920 -7 Left 1056806915 9:89736161-89736183 CCCACACTCTTGCTGGCTGTCAG No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data
1056806914_1056806920 -6 Left 1056806914 9:89736160-89736182 CCCCACACTCTTGCTGGCTGTCA No data
Right 1056806920 9:89736177-89736199 CTGTCAGCAGGGGCTGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056806920 Original CRISPR CTGTCAGCAGGGGCTGCTCT CGG Intergenic